Free Republic
Browse · Search
News/Activism
Topics · Post Article

Positive impacts of volcanoes
1 posted on 03/23/2011 1:52:07 AM PDT by AdmSmith
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv; decimon; neverdem; nuconvert

Original article http://www.pnas.org/content/early/2011/03/14/1019191108.abstract


2 posted on 03/23/2011 1:53:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

Holy Cow! L. Ron was right!?


3 posted on 03/23/2011 1:59:35 AM PDT by DeltaZulu
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith
......In the 1950s, Stanley Miller and Harold Urey of the University of Chicago performed a series of "spark discharge" experiments, in which the researchers applied electrical sparks-- meant to simulate lightning -- to a mixture of gases in steam-filled flasks...


5 posted on 03/23/2011 2:26:01 AM PDT by Cincinatus' Wife
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

One spark-discharge experiment using radioactivity ran all night and in the morning the vessel was found broken open. Little footprints of black goo led to the window and a note was left........ What did the note say?
“Gone fission!”


6 posted on 03/23/2011 3:46:47 AM PDT by count-your-change (You don't have be brilliant, not being stupid is enough.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith
Since Miller and Urey's experiment was utterly discredited as an origin-of-life scenario, the scientists have now backed off and want to use it as a scenario for the origin of proteins/amino acids. Fine, but it does not solve the REAL problem in origin of life: Where did the information contained in DNA and RNA come from?
8 posted on 03/23/2011 4:56:38 AM PDT by backwoods-engineer (Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

“Well, Bobby, another one of those big questions for Mr. Science. ‘Can volcanoes produce life?’ Hmmm. You know the Mr. Science motto, ‘Doing Is Knowing!’ We have here a bowl of boiling cheese-dip to simulate the lava in a volcano. Here is our bottle of hydrogen and a sparkler to simulate lightning. Just a second. The court order requires that the fire department be notified whenever I conduct an experiment. Have we done that Director Lisa? OK! Here we go. We turn on the hydrogen...and put the lit sparkler over the cheese. HOTCHEESE!!!HOTCHEESE!!!HOTCHEESE!!! Thanks Cameraman Steve. That cheese-lava can really scald you. Once again, science triumphs over superstition! ‘Can volcanoes produce life?’ The answer is no, volcanoes can produce third-degree burns. Mr. Science has been receiving letters requesting him at birthday parties. The District Attorney has threatened to throw Mr. Science in Jail ‘until the end of time’ if he works at any more birthday parties. I will be at the Harrison Avenue Mall this Saturday from noon to four demonstrating volcanoes. Free nachos, too!”


16 posted on 03/23/2011 8:03:26 AM PDT by blueunicorn6 ("A crack shot and a good dancer")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: AdmSmith

This is as likely as a Boeing 757 being left behind after a tornado sweeps through a junk yard. And this theory fails to account for the information required to assemble amino acids into proteins. And, it fails to account for teleonomy and autopoiesis. I will invoke Polanyi’s Impossibility here!


20 posted on 03/23/2011 7:06:25 PM PDT by LiteKeeper ("Psalm 109:8")
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson