Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

U.S. oil production hit 20-year milestone in November
Fuel Fix ^ | February 27, 2013 | Don Mason

Posted on 02/27/2013 2:09:46 PM PST by thackney

U.S. oil production averaged 7.013 million barrels a day in November, the first time since 1992 that the average daily production during a month has exceeded 7 million, according to revised government figures.

The Energy Information Administration on Wednesday revised the November figure up from 6.893 million barrels per day. Average daily production during a month had last reached 7 million in December 1992, according to agency figures.

Production for December 2012 rose to 7.03 million barrels per day the agency said, still below the December 1992 figure of 7.1 million barrels per day.

For all of 2012, production averaged 6.474 million barrels per day, the highest since 6.56 million barrels per day in 1995, according to the Energy Information Administration.


TOPICS: News/Current Events
KEYWORDS: energy; oil

1 posted on 02/27/2013 2:09:51 PM PST by thackney
[ Post Reply | Private Reply | View Replies]

Image and video hosting by TinyPic

Image and video hosting by TinyPic

U.S. Field Production of Crude Oil
http://www.eia.gov/dnav/pet/hist/LeafHandler.ashx?n=PET&s=MCRFPUS2&f=M

2 posted on 02/27/2013 2:14:45 PM PST by thackney (life is fragile, handle with prayer)
[ Post Reply | Private Reply | To 1 | View Replies]

To: thackney
Hmmmm, something happened in 2009 . . . what was it?
3 posted on 02/27/2013 2:17:06 PM PST by ksen
[ Post Reply | Private Reply | To 1 | View Replies]

To: ksen
September 2008, Hurricane shutting down significant Offshore production, just like Sept 2005.

Image and video hosting by TinyPic

4 posted on 02/27/2013 2:28:21 PM PST by thackney (life is fragile, handle with prayer)
[ Post Reply | Private Reply | To 3 | View Replies]

To: ksen

Link for specific data and dates:

Federal Offshore—Gulf of Mexico Field Production of Crude Oil
http://www.eia.gov/dnav/pet/hist/LeafHandler.ashx?n=pet&s=mcrfp3fm2&f=m

If you were thinking of the Deep Water Horizon / Macondo / BP blowout and spill, that affected drilling, not really production.


5 posted on 02/27/2013 2:30:53 PM PST by thackney (life is fragile, handle with prayer)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; ColdOne; Convert from ECUSA; ...

Thanks thackney.


6 posted on 02/27/2013 8:01:19 PM PST by SunkenCiv (Romney would have been worse, if you're a dumb ass.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

http://www.nytimes.com/2013/02/28/business/energy-environment/afl-cio-backs-keystone-oil-pipeline-if-indirectly.html?


7 posted on 02/28/2013 1:59:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson