Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The Current Ebola Strain: It’s Airborne Folks
The Conservative Treehouse ^ | 8-5-14 | sundance

Posted on 08/05/2014 6:15:51 PM PDT by sheikdetailfeather

The empirical evidence of an airborne Ebola Strain is overwhelming

Hat Tip GWP - Patrick Sawyer was the American businessman, who contracted Ebola while working in Liberia, then collapsed after he got off a plane to Nigeria and died July 25. He was the first patient in Nigeria with the Ebola virus. The Nigerian authorities have refused to release the names of other passengers on the plane with Mr. Sawyer, or notify the media of their status.

(Excerpt) Read more at theconservativetreehouse.com ...


TOPICS: News/Current Events; Politics/Elections
KEYWORDS: airborne; airborneebola; barackobama; cdc; czar; democrats; doctor; ebola; ebolagate; ebolagraph; ebolainamerica; ebolaoutbreak; ebolaphonywar; ebolavaccine; ebolavirus; emory; epidemic; frieden; health; healthcare; hospital; jahrling; mutation; nigeria; nih; noitsnot; obama; obamasfault; obola; outbreak; pandemic; peterjahrling; protocols; publichealth; quarantine; quarantined; strain; talkradio; thomasfrieden; vaccine; who
Navigation: use the links below to view more comments.
first previous 1-20 ... 241-260261-280281-300301-302 last
To: AdmSmith

http://www.bloomberg.com/news/2014-08-12/unproven-ebola-drugs-are-ethical-to-use-in-outbreak-who.html


301 posted on 08/12/2014 9:00:20 AM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 297 | View Replies]

To: Black Agnes; exDemMom; nuconvert; Pox; Cold Heat

WHO: Ebola death toll may ‘vastly underestimate’ outbreak
http://www.macleans.ca/society/health/who-ebola-toll-may-vastly-underestimate-outbreak/

I do not think that this will contain the virus:
http://thenewsnigeria.com.ng/2014/08/14/pilgrims-with-ebola-will-be-disqualified-from-hajj-nahcon/

This is not true:
Saudi Arabia is free of Ebola virus — official
http://www.kuna.net.kw/ArticleDetails.aspx?id=2391934&Language=en


302 posted on 08/15/2014 12:17:49 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 300 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 241-260261-280281-300301-302 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson