Free Republic
Browse · Search
News/Activism
Topics · Post Article

Putin's not even fooling his own people anymore. Eventually some of his fans here will wake up.

“Russian public opinion, in fact, does not support the idea of invasion: the latest polls by the Moscow Public Opinion Foundation showed that only 5 per cent of Russians want the regular army to fight in Ukraine. But not many Russian citizens are ready to demonstrate against the war.”

1 posted on 08/29/2014 5:46:23 AM PDT by elhombrelibre
[ Post Reply | Private Reply | View Replies ]


To: elhombrelibre

Nice to see that Baghdad Bob is working again.


2 posted on 08/29/2014 5:51:20 AM PDT by Slings and Arrows ("Your Daddy Was Drunk and Your Mama Was Lonely" - http://youtu.be/4HYy62qiOwA)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

Putin has learned how to lie well from obama, the LIAR in chief. I’m rather surprised putin hasn’t blamed his invasion on Bush.


3 posted on 08/29/2014 5:52:56 AM PDT by freeangel ( (free speech is only good until someone else doesn't like it)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

IMHO he is just biding his time and waiting for Winter. He can then go without Euros longer than Europeans can go without heat, and everyone knows that. So the EU will get their gas when he gets the Ukraine.


5 posted on 08/29/2014 6:01:48 AM PDT by jdsteel (Give me freedom, not more government.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

If Barack won’t call it an invasion it must not be an invasion! Period!


6 posted on 08/29/2014 6:06:48 AM PDT by TexasCajun
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre
Putin's not even fooling his own people anymore. Eventually some of his fans here will wake up.

Did he learn that from us or did we learn that from him"

7 posted on 08/29/2014 6:21:03 AM PDT by Don Corleone ("Oil the gun..eat the cannoli. Take it to the Mattress.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

In Russia and America, the will of the people is irrelevant. The government will do as it damn well pleases and it’s up to the propagandists to sell it. Here, that’s the mission of the MSM.


10 posted on 08/29/2014 6:46:33 AM PDT by Spok ("What're you going to believe-me or your own eyes?" -Marx (Groucho))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre
In my best voice Who knew? lol
11 posted on 08/29/2014 7:11:03 AM PDT by Phlap (REDNECK@LIBARTS.EDU)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

Russia acts like our own politicians. The difference is that Russia is being belligerent against a foreign nation and out politicians are being belligerent against the People.


12 posted on 08/29/2014 7:33:42 AM PDT by trebb (Where in the the hell has my country gone?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre
today one of my movement's activists Dmitry Monakhov went out to the Kremlin's walls to demand Putin stop his war in Ukraine. Police violently grabbed him and now Monakhov is facing a psychiatric exam. Any anti-war protester could either end up behind bars or in a psychiatric clinic, " Chirkova said

Good grief, it's not as if they were Tea Partiers or something.

13 posted on 08/29/2014 8:04:27 AM PDT by Madame Dufarge
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

Like so many of these threads, if the posters don’t want to openly defend the new Soviet Putin, then they turn the thread into an anti-America thread, or anti-Obama thread as an indirect way of diluting or sidetracking criticism of the Russian goals they support.


14 posted on 08/29/2014 8:07:55 AM PDT by ansel12 (LEGAL immigrants, 30 million 1980-2012, continues to remake the nation's electorate for democrats)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre
I think what's worse is the invasion that our administration insists isn't taking place that is taking place.
29 posted on 08/29/2014 10:37:17 AM PDT by BradyLS (DO NOT FEED THE BEARS!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

Instead of creating WWIII Putin should have worked on Russia’s economy which would have helped his people. This little man is just as insane as Hitler was and he eventually will put Russia in the trash heap. This little man says he has nukes? What? Damn what a stupid nitwit. Most of the damn world has them and what does this idiot think our armament is?


31 posted on 08/29/2014 11:35:44 AM PDT by Logical me
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre
What?
Commies NEVER lie.
Period!!!
35 posted on 08/29/2014 2:41:52 PM PDT by Amagi (Lenin: "Socialized Medicine is the Keystone to the Arch of the Socialist State.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre
Russia Lies About Invading Ukraine as It Invades Ukraine

Obama Lies About Defending Our Border As He Works On Amnesty For All

36 posted on 08/29/2014 9:10:25 PM PDT by OrangeHoof (Every time you say no to a liberal, you make the Baby Barack cry.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre; SunkenCiv; gandalftb; nuconvert; TigerLikesRooster; Greetings_Puny_Humans; GeronL; ..
This will work:

U.K. Wants EU to Block Russia From SWIFT Banking Network http://www.bloomberg.com/news/2014-08-29/u-k-wants-eu-to-block-russia-from-swift-banking-network.html

and increase the oil production:

The main cause for the recent fall in oil prices is that weakening demand is being met by rising production. West African crude exports to Asia were near record levels in September, a Reuters survey of traders showed, and the North Sea market remained well supplied.

Production from the Organization of the Petroleum Exporting Countries (OPEC) rose, despite conflicts in Iraq and Libya.
OPEC, which supplies a third of the world's oil, raised its output in August from July, with higher supply from Libya, Angola and Iran, a Reuters survey found.

http://www.dailytimes.com.pk/business/30-Aug-2014/brent-oil-rises-on-ukraine-crisis-but-heads-for-monthly-fall

the result will be this:

“With the significant deterioration in the Ukrainian situation, markets may treat this as a Lehman-style shock,” Kantarovich wrote in an e-mailed report Friday. “Revisiting the post-Lehman lows would imply downside of 50 percent from an index perspective.”

The bank recommends reducing Russian investments because “markets may no longer assume a quick and easy resolution of the conflict and ‘worse before better’ seems a likely sequence.”

http://www.Newsmax.com/Finance/JPMorgan-Russia-Ukraine-stocks/2014/08/29/id/591641

38 posted on 08/30/2014 2:03:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: elhombrelibre

If that is the case then Putin better get this war over with quickly by hitting the Ukrain with the big hammer, smashing thier military and taking control of the region.

Before installing the sepertist as the new government and getting out.

Let the seperiotist handle all the domestic messyness for a few years, while Putin and Russia claim to take their hands off the sittuation.

(Thus leaving the west do do what it won’t do commit troops to restore pro-westerns to power)

In a few years after the sepertist have taken control of crimina and the Ukraine is still struggling wiht itself. Russia can move in to do the formal annexation of the Nation of Crimina. Easy and clean.


55 posted on 08/30/2014 5:57:25 PM PDT by Monorprise
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson