Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

‘Alien’ mosquitos from East Asia taking over Italy could be vector for viruses – study
Toronto 99 ^ | 10-21-21 | Toronto99

Posted on 10/21/2021 10:03:37 AM PDT by Brookhaven

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last
To: SunkenCiv

Thank you for the heads up, This is an important one for myself. They say... That type O blood came from evolutionary resistance to Malaria. The incredible thing is that when looking at a map of ancient blood types, Type O is almost exclusive to South America at 99% with a small swath of 99% through North America that originated on the West coast and spread East. Almost none at all in the other “origin” Continents. Only one small location in Northern New Zealand. How could that be?


41 posted on 10/24/2021 5:32:16 PM PDT by Openurmind (The ultimate test of a moral society is the kind of world it leaves to its children. ~ D. Bonhoeffer)
[ Post Reply | Private Reply | To 39 | View Replies]

To: Brookhaven

42 posted on 10/24/2021 5:43:13 PM PDT by Rebelbase (Were State Dept. Havana Syndrome victims the guinea pigs of 5G/graphene oxide "vaccine" tests?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Openurmind

It happened because it happened, and nothing to do with evolutionary resistance. The genome is mostly stable but slowly altered via copying errors. Natural selection is a search for “must be the reason”, and IMHO just 19th century secular superstition.

OTOH, it’s long been known that a single gene (one from one parent) for sickle cell protects against malaria, while two genes (one from each parent) is no freakin’ good, and actually makes carriers more susceptible to the effects of malaria.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3499995/

sidebars:

https://dnalc.cshl.edu/view/15404-Chromosome-9-gene-for-blood-group-Matt-Ridley.html
https://freerepublic.com/focus/chat/3993910/posts?page=5#5


43 posted on 10/24/2021 6:06:31 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 41 | View Replies]

(dead link)
GENOME
the autobiography of
a species in 23 chapters

by Matt Ridley
(from chap 9)
The different kind blood group you have determines your susceptibility to certain diseases. For example, people with A blood are less likely to get diarrhoea than people with B blood. People with O blood are more susceptible to getting diarrhoea than anybody else. People with AB blood are virtually immune to diarrhoea because of their resistance. Nobody really yet knows how AB genotype protects them from this disease. "Since people with the O blood are the most susceptible to the disease, shouldn't they die out according to natural selection?' you are probably asking. That is true but there are a couple of things that keep the O group alive and one of them is malaria. People with O blood are more resistant to malaria than other groups. Another thing is that the O group is less likely to get certain cancers. These benefits cancel out the negative effect that the O blood group has on the diarrhoea disease so, this balance has kept the group from disappearing.

44 posted on 10/24/2021 6:06:53 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

My curiosity was how could it be type O as 99% of South America, yet very diluted in the so called origin of man?

I am sure they have had Mosquitoes and Malaria since the beginning of time in the old world and the far east.

Logic would dictate it should be the other way around right? If man came from Africa, Asia, and then east to the new world?

Logic is type O originated from South America and then spread west... But that opens another door...


45 posted on 10/24/2021 8:12:42 PM PDT by Openurmind (The ultimate test of a moral society is the kind of world it leaves to its children. ~ D. Bonhoeffer)
[ Post Reply | Private Reply | To 43 | View Replies]

To: Openurmind

Well, chromosome 9 has our primary bloodtype coding.

Type A and Type B differ by I think it is 16 base pairs.

Type O is otherwise identical with Type A, but missing the first base pair.

Given that A is as common as O, and B appears to be an isolate mutation of A from a long time ago, it’s apparent that O is older than B but younger than A.


46 posted on 10/24/2021 9:42:30 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 45 | View Replies]

To: Openurmind

Ah, here it is:

[snip] The ABO gene codes for an enzyme called galactosyl transferase and determines your blood group. In people with A and B blood groups, the gene differs by seven basepairs, four of which have an effect on the type, shape and activity of the enzyme. People with O blood group have a single deletion in the gene that causes an inactive protein to be made.[/snip]

https://dnalc.cshl.edu/view/15404-Chromosome-9-gene-for-blood-group-Matt-Ridley.html


47 posted on 10/24/2021 10:21:29 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 45 | View Replies]

To: Brookhaven; nuconvert
We should be positive and use gene technology.

Gene drive: self-destructing mosquitoes

The process is made possible by what is called “gene drive”. This consists of introducing genetically modified organisms designed to propagate a chosen trait, in this case a gene that kills females during development. Gene drives involves distorting inheritance in favor of the gene that we are interested in being transmitted. It consists of breaking the probability that a baby has a 50% of inheriting any gene from any of the parents. Gene drives manages to raise the probability to 80-90%, thus guaranteeing that a new introduced gene spreads in the population generation after generation until the majority of individuals possess it.

http://www.mosquitoalert.com/en/gene-drive-self-destructing-mosquitoes/

48 posted on 10/29/2021 12:29:34 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson