This is a nonsense.
You're welcome to present your own DNA studies which show anything to the contrary. Oh, right, you don't have any.
As someone said: "Nearly 75% of human genes have some counterpart in nematodes--a soil-dwelling worm that is about four thousandths of an inch long. Does that mean that a nematode is 75% human?"
No, because you've obviously pulled a dishonest bait-and-switch. The original statement was that Chimp and Human DNA was 98+% *IDENTICAL*. And it is.
Suddenly, you're talking about only having "some counterpart", which is a *much* broader type of comparison. Furthermore, your creationist source has further stretched the comparison... While the human/chimp comparison is across the *entire* genome, the alleged "75%" comparable human/nematode comparison is only that "Of the 5000 best known human genes, three fourths have close analogues in the nematode." (Note that 5000 human genes is only 6% of the *total* number of human genes.) So only a *partial* comparison of "close analogues" turns up 75% "similarity" (not 75% exact match). Also note that the "best known" human genes are quite commonly the ones that run the basic cellular machinery, which *would* be more likely to be shared in at least some form with other multi-celled animals -- the genes that make us more uniquely human are mostly still in the territory of "unknown" genes.
To further demonstrate the dishonesty of the implied "75% same" claim, note that the nematode DNA has only 97 million base pairs of DNA, compared to 3,000+ million base pairs for humans. Human DNA has over THIRTY TIMES THE VOLUME of information as the nematode DNA. Even if *every* nematode DNA sequence matched *exactly* a human DNA sequence (and they sure as hell don't), that would at *MOST* make for only a 3.2% human/nematode DNA match. And that's the *absolute maximum* amount of match that could *possibly* exist, since the entire nematode DNA is only 3.2% as large as the human DNA. Your creationist source sort of "forgot" to point that out, didn't it?
When are you folks going to stop believing what creationist sources try to mislead you into believing about science?
To further underscore the dishonest implications of the creationist claims, let's look at one of the "similar" genes, shall we? The following is an actual comparison between a gene in nematodes (top line, UNC-76) and the homologous gene in humans (bottom two lines, FEZ1 & FEZ2):
Note that even what the creationist source tries to imply as one of the "gene matches" is actually vastly different when you look at the actual amino acid sequences. Not only are there dozens of mismatched amino acides, but the sequences are differing lengths, and there are many insertion/deletion differences (marked by the dashed lines to stretch one sequence to match up with the other).
(The above is from The Caenorhabditis elegans gene unc-76 and its human homologs define a new gene family involved in axonal outgrowth and fasciculation)
So, rather than "75% the same", what we *really* find when we compare nematode DNA versus human DNA is that when you look at only the best known 6% of human genes (which are mostly regulatory and likely to be found in many creatures), about 75% of them can be matched to *some* superficially similar gene in a nematode, even though the "matches" show gross differences in length, encoding, and sequences which are present in one but not the other (and vice versa), making for a "half match" at best. By my math that's a 2.25% overall "match" at best.
Human/Chimp comparisons of similar genes, on the other hand, show far tinier differences -- in keeping with the 98+% similarity. For example, check out this comparison of human/chimp/gorilla/orangutan CHRM2 gene for muscarinic acetylcholine receptor m2. The human gene sequence is on the top 2 lines (from 2 different gene sequencing projects), the following lines are for the other primates. A "." indicates an identical match, a letter indicates a differing base pair.
seq id sequence name
-----------------------------
1 human (M16404 in Database) - local file -
2 human (SN; AB041391 determined by Silver Project) - local file -
3 chimpanzee (220; AB041392 determined by Silver Project) - local file -
4 gorilla (U1; AB041393 determined by Silver Project) - local file -
5 orangutan (U1; AB041394 determined by Silver Project) - local file -
nucleotides 1 - 60
1 ttgtcctggtggctggatccctcagtttggtgaccattatcgggaacatcctagtcatgg
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 61 - 120
1 tttccattaaagtcaaccgccacctccagaccgtcaacaattactttttattcagcttgg
2 ............................................................
3 ............................................................
4 .................................................g..........
5 ...............................t.................g..........
-------------------------------+-----------------+----------
nucleotides 121 - 180
1 cctgtgctgaccttatcataggtgttttctccatgaacttgtacaccctctacactgtga
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 181 - 240
1 ttggttactggcctttgggacctgtggtgtgtgacctttggctagccctggactatgtgg
2 ............................................................
3 ............................................................
4 ............................................................
5 .........................t..................................
-------------------------+----------------------------------
nucleotides 241 - 300
1 tcagcaatgcctcagttatgaatctgctcatcatcagctttgacaggtacttctgtgtca
2 ............................................................
3 ............................................................
4 ............................................................
5 .............g..............................................
-------------+----------------------------------------------
nucleotides 301 - 360
1 caaaacctctgacctacccagtcaagcggaccacaaaaatggcaggtatgatgattgcag
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 361 - 420
1 ctgcctgggtcctctctttcatcctctgggctccagccattctcttctggcagttcattg
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 421 - 480
1 taggggtgagaactgtggaggatggggagtgctacattcagtttttttccaatgctgctg
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 481 - 540
1 tcacctttggtacggctattgcagccttctatttgccagtgatcatcatgactgtgctat
2 ............................................................
3 ............................................................
4 ................c...........................................
5 ................c.........................................g.
----------------+-----------------------------------------+-
nucleotides 541 - 600
1 attggcacatatcccgagccagcaagagcaggataaagaaggacaagaaggagcctgttg
2 ............................................................
3 .................................................a..........
4 ............................................................
5 .c..........................................................
-+-----------------------------------------------+----------
nucleotides 601 - 660
1 ccaaccaagaccccgtttctccaagtctggtacaaggaaggatagtgaagccaaacaata
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 661 - 720
1 acaacatgcccagcagtgacgatggcctggagcacaacaaaatccagaatggcaaagccc
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 721 - 780
1 ccagggatcctgtgactgaaaactgtgttcagggagaggagaaggagagctccaatgact
2 ............................................................
3 ............................................................
4 ............................................................
5 ....a................................a......................
----+--------------------------------+----------------------
nucleotides 781 - 840
1 ccacctcagtcagtgctgttgcctctaatatgagagatgatgaaataacccaggatgaaa
2 ............................................................
3 ............................................................
4 ............................................................
5 ........................................c...................
----------------------------------------+-------------------
nucleotides 841 - 900
1 acacagtttccacttccctgggccattccaaagatgagaactctaagcaaacatgcatca
2 ............................................................
3 ............................................................
4 ............................................................
5 .......c................................t...................
-------+--------------------------------+-------------------
nucleotides 901 - 960
1 gaattggcaccaagaccccaaaaagtgactcatgtaccccaactaataccaccgtggagg
2 ............................................................
3 ............................................................
4 ............................................................
5 ...................c....t.............t.....................
-------------------+----+-------------+---------------------
nucleotides 961 - 1020
1 tagtggggtcttcaggtcagaatggagatgaaaagcagaatattgtagcccgcaagattg
2 ............................................................
3 ............................................................
4 ............................................................
5 .......a....................................................
-------+----------------------------------------------------
nucleotides 1021 - 1080
1 tgaagatgactaagcagcctgcaaaaaagaagcctcctccttcccgggaaaagaaagtca
2 ............................................................
3 ............................................................
4 ................n...........................................
5 ............................................................
----------------+-------------------------------------------
nucleotides 1081 - 1140
1 ccaggacaatcttggctattctgttggctttcatcatcacttgggccccatacaatgtca
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 1141 - 1200
1 tggtgctcattaacaccttttgtgcaccttgcatccccaacactgtgtggacaattggtt
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 1201 - 1260
1 actggctttgttacatcaacagcactatcaaccctgcctgctatgcactttgcaatgcca
2 ............................................................
3 ....................................................t.......
4 ....................................................t.......
5 ....................................................t.......
----------------------------------------------------+-------
nucleotides 1261 - 1320
1 ccttcaagaagacctttaaacaccttctcatgtgtcattataagaacataggcgctacaa
2 ............................................................
3 ............................................................
4 ............................................................
5 ............................................................
------------------------------------------------------------
nucleotides 1321 - 1332
1 ggtaaaa-----
2 ............
3 .......tatct
4 ............
5 ............
-------+++++
Note the *huge* stretches of hundreds of absolutely *identical* basepairs. The chimp gene differs from the human gene by only *TWO* base pairs out of 1327 base pairs (plus 5 base-pairs of probable "junk" on the end, genes often have "fuzz" on either end, but even 7 out of 1332 bp differences is only 0.5% difference, or 99.5% similarity). Note also that the gorilla gene differs more from the the human DNA than does the chimp, and the orangutan even moreso. This implies a "family tree" of:
0
1 +--- 1 humDB
+---| 0
2 | +--- 2 humSN
+---| 1
| +------- 3 chi220
+---| 0
| +----------- 4 gorU1
| 14
+--------------- 5 oranU1
And the next time you want to present what you think are scientific facts, try getting them from science sources instead of creationist sources.
There is a misleading and prevailing misconception that each organism or a cell develops out of DNA.
It does.
It never happens, during the division of already existing cell the DNA gets replicated and inherited by each cell to be used as a library of genes.
Yes, exactly. And the additional "cell machinery" for the doubled cell is built via instructions from the DNA (both nuclear and mitochondrial).
During the seuxal reproduction, DNA gets recombinated inside of already existing cells.
Yes, so?
Very different species can use even the same library in a different way and order.
You are invited to document this amazing claim.