Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The Current Ebola Strain: It’s Airborne Folks
The Conservative Treehouse ^ | 8-5-14 | sundance

Posted on 08/05/2014 6:15:51 PM PDT by sheikdetailfeather

The empirical evidence of an airborne Ebola Strain is overwhelming

Hat Tip GWP - Patrick Sawyer was the American businessman, who contracted Ebola while working in Liberia, then collapsed after he got off a plane to Nigeria and died July 25. He was the first patient in Nigeria with the Ebola virus. The Nigerian authorities have refused to release the names of other passengers on the plane with Mr. Sawyer, or notify the media of their status.

(Excerpt) Read more at theconservativetreehouse.com ...


TOPICS: News/Current Events; Politics/Elections
KEYWORDS: airborne; airborneebola; barackobama; cdc; czar; democrats; doctor; ebola; ebolagate; ebolagraph; ebolainamerica; ebolaoutbreak; ebolaphonywar; ebolavaccine; ebolavirus; emory; epidemic; frieden; health; healthcare; hospital; jahrling; mutation; nigeria; nih; noitsnot; obama; obamasfault; obola; outbreak; pandemic; peterjahrling; protocols; publichealth; quarantine; quarantined; strain; talkradio; thomasfrieden; vaccine; who
Navigation: use the links below to view more comments.
first previous 1-20 ... 221-240241-260261-280 ... 301-302 next last
To: Cold Heat

Infective not quite as you describe.

Can be shedding virus for a week prior to crashing.

As long as they are shedding in any manner including sex they aw WILL infect whoever contacts them unless they are in a full biohazard suit.

Virtually every person who has come in direct contact with an Ebola patient has contracted it.

It has now gone exponential in Liberia and they show ZERO sign of peaking - meaning much worse to come.

Expect it to be a mirror in the US wherever it eats in the wild.


241 posted on 08/08/2014 11:42:57 AM PDT by LurkingSince'98 (Ad Majoram Dei Gloriam = FOR THE GREATER GLORY OF GODs)
[ Post Reply | Private Reply | To 240 | View Replies]

To: LurkingSince'98
Virtually every person who has come in direct contact with an Ebola patient has contracted it.

That's just not true.

To become infected the virus has to find it's way into your blood, through a mucous membrane or cut.

That means you have to get it in places that some very minor and standard precautions would prevent.

The issue in Africa is that these minor precautions were not being taken. Initially not even by the medical people until they understood that it was Ebola.

The viral load is so high that once you get it on the surface of a gown or glove, great care has to be taken when to remove those items and with no decon room or clean facility to doff all the contaminated stuff, the risk is high that you might get a bit on a finger and later wipe your eye.

We don't have that problem in our facilities. They have protocols and decon routines.

As to our citizens, I think they have far more common sense then to kiss a corpse of a family member who has died of a disease of any kind. Much less keep the body in the house.

Just sayin...

You can take it or leave it.

242 posted on 08/08/2014 12:03:06 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 241 | View Replies]

To: LurkingSince'98

BTW, anyone with the onset symptoms of Ebola and also has enough of it to shed, will not likely be having sex.


243 posted on 08/08/2014 12:04:27 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 241 | View Replies]

To: Cold Heat

You’d think.

I remember, though, from reading Hot Zone that one of the early cases of either Marburg or Ebola loved to visit the local ladies of the night. And spread it all through a village that way.


244 posted on 08/08/2014 12:06:21 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 243 | View Replies]

To: Black Agnes
Hot zone has a lot of exaggerations or bad assumptions in it...I don't recall that passage, but it sounds like Marburg.

You probably know what it's like to get hammered by the flu. One day you wake up and wish you had not, or you get slammed by it during the day....pain all over...fever..etc..

Ebola is even worse by multiples..

245 posted on 08/08/2014 12:30:50 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 244 | View Replies]

To: Cold Heat; exDemMom; Pox

Ín this tread http://www.singtomeohmuse.com/viewtopic.php?t=5725&start=825
there is mainly news articles about Ebola.


246 posted on 08/08/2014 12:36:10 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 240 | View Replies]

To: Cold Heat

I just keep thinking of the video of Patrick Sawyer in the airport.

He obviously knew something was amiss as he was consciously avoiding people. But he wasn’t incapacitated either for several more hours.


247 posted on 08/08/2014 12:42:56 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 245 | View Replies]

To: AdmSmith

That’s a good link, thanks.

Looks like another Saudi is infected:

http://www.saudigazette.com.sa/index.cfm?method=home.regcon&contentid=20140808213981


248 posted on 08/08/2014 12:45:25 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 246 | View Replies]

To: AdmSmith

Yeah....some interesting news collected there particularly about Nigeria.

Personally I have taken the position that the Nigerian outbreak is contained. I hope I am correct.


249 posted on 08/08/2014 12:57:38 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 246 | View Replies]

To: Black Agnes
They guy was very sick at the time he traveled and he was also extremely pig headed. No doubt also scared to death.
250 posted on 08/08/2014 12:59:23 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 247 | View Replies]

To: Cold Heat

A great deal of denial too probably.

‘It’s just a headache’, ‘it’s just a touch of the flu’, ‘it’s just malaria’, etc.


251 posted on 08/08/2014 1:10:02 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 250 | View Replies]

To: Cold Heat

Not true many confirmed cases in the literature of spouses transmitting it to their wives via their sperm prior to their being symptomatic.


252 posted on 08/08/2014 1:54:19 PM PDT by LurkingSince'98 (Ad Majoram Dei Gloriam = FOR THE GREATER GLORY OF GODs)
[ Post Reply | Private Reply | To 243 | View Replies]

To: Cold Heat

Not true many confirmed cases in the literature of spouses transmitting it to their wives via their sperm prior to their being symptomatic.


253 posted on 08/08/2014 1:54:36 PM PDT by LurkingSince'98 (Ad Majoram Dei Gloriam = FOR THE GREATER GLORY OF GODs)
[ Post Reply | Private Reply | To 243 | View Replies]

To: LurkingSince'98

While that could happen. it’s unlikely to be anything close to a relevant transmission factor.

In other words, it would be the least likely of many other ways.

The virus is not like aids.....period.


254 posted on 08/08/2014 2:53:16 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 252 | View Replies]

To: Cold Heat

Why don’t you ask the wives who were infected by their asymptomatic husbands whether it was a ‘relevant transmission factor’?

Transmission is transmission and since each wife so infected can turn around and infect her children, neighbors and friends, let along medical workers.

Maybe later at postmortem you could ask them if they thought it was a ‘relevant transmission factor’ too.

With any agent as infective as Ebola, which BTW both CDC and WHO consider one of the most infective virus known, every single mode of transmission must be identified and stopped.

Your local public health officials have spent decades doing that very thing for syphilis, AID, polio, whooping cough, etc.

Difference is by the time they hear about it the entire path of transmission is either dead or dying.

You spend a lot of time in your discussions minimizing one of the single most infections agent known to man.

Why? Do you honestly think that the low information voters, welfare folks, WalMartians, drug abusers and psychopaths are going to snap out of it and do what must be done??

never gonna happen.


255 posted on 08/08/2014 3:27:54 PM PDT by LurkingSince'98 (Ad Majoram Dei Gloriam = FOR THE GREATER GLORY OF GODs)
[ Post Reply | Private Reply | To 254 | View Replies]

To: AdmSmith

The Saudi articles are disturbing. There is likely a cluster developing in Saudi right now.


256 posted on 08/08/2014 3:48:40 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 246 | View Replies]

To: LurkingSince'98

Frankly, I don’t think it happened. I have explained what Ebola does to a person and why they likely did not have sex to celebrate. So I’m not going to participate in this asinine shit.

But I’m not going to convince you because you believe the BS in the Hot Zone. You are nearly hysterical. You deserve to be.

Carry on......


257 posted on 08/08/2014 8:35:36 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 255 | View Replies]

To: Black Agnes

Last I heard it was a cluster of 2...


258 posted on 08/08/2014 8:36:13 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 256 | View Replies]

To: Cold Heat

The 40yr old, his wife and their 3 daughters.

Plus he went to work for a day or so while feeling somewhat unwell. And was in the hospital in a regular hospital room for a day or so before he was transferred to the isolation unit.


259 posted on 08/08/2014 8:47:25 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 258 | View Replies]

To: Black Agnes

My understanding was that they were quarantined. I was not aware that they were tested and were positive.


260 posted on 08/08/2014 8:50:11 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 259 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 221-240241-260261-280 ... 301-302 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson