Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Obama weighs selling U.S. arms to Hanoi in bitter irony for Vietnam veterans
Washington Times ^ | 5/22/16 | Dave Boyer

Posted on 05/22/2016 7:33:00 PM PDT by Nachum

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 last
To: Shady

And we get a quote from the lying Ben Rhodes who laughed about how he lied about the Iranian “DEAL”? Stopped reading right there!


61 posted on 05/23/2016 4:35:58 AM PDT by blaveda
[ Post Reply | Private Reply | To 53 | View Replies]

To: ThanhPhero; SunkenCiv

I agree, this is a positive step.


62 posted on 05/23/2016 4:36:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 48 | View Replies]

To: Nachum

“Bitter irony”?
How about “outright betrayal”?


63 posted on 05/23/2016 4:44:58 AM PDT by ctdonath2 ("Get the he11 out of my way!" - John Galt)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Nachum

Obama is trying to undercut Richard Roper.


64 posted on 05/23/2016 7:45:33 AM PDT by pas
[ Post Reply | Private Reply | To 1 | View Replies]

To: Doogle
Chelsea is going to run the FOUNDATION, should Hillary get selected? can you believe? and yes, she is the spiting image of her DNA poppa.

So thanks for reminding me to add her...

65 posted on 05/23/2016 8:06:59 PM PDT by haircutter
[ Post Reply | Private Reply | To 50 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-65 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson