Chimps Now to be Considered Humans

Some dolphins brains are bigger than yours and mine.

That is correct, but ours have far more convolutions (folds), thus the surface area of our brains is larger. That's one of the reasons we are smarter than dolphins, and also why we are smarter than apes. Our brains are far more evolved or advanced.

I think we can solve this quite easily. From now on liberals will be known as... chimps.

No way do chimps deserve membership in Homo. Look at what "Genus" means:

WHAT IS HOMO?

The early species Homo rudolfensis and H. erectus did not reach the brain capacity of the Neanderthals (1,600 cc) or H. sapiens (1,350 cc), but the increase from the australopithecine brain of 450 cc to the 700-900 cc of H. rudolfensis is almost a doubling of size and a much greater advance than the shift from 900 cc to 1,350 cc, an increase that I do not consider to be of generic value. A genus usually indicates an ecological unit, a noticeable difference in the exploitation of the environment. The designation Homo does have such a significance. It designates the emancipation from dependence on trees. Once this independence was achieved, a premium was placed on the enhancement of intelligence, provided the evolutionary unit was small enough to respond to selection. The evolutionary increase of brain size ended when selection for further increase was no longer rewarded by a reproductive advantage.
Ernst Mayr, What Evolution Is (2001), pg 235

Then again, when I see something like this hairless chimp (due to some kind of disease IIRC), I gotta wonder...

The Capuchin monkey, which many experimental psychologists regard as equal in docility (i.e., educability) to any highly gifted chimpanzee, possesses an almost smooth brain surface, whereas the chimpanzee has a wrinkled one that comes close to that of man.

What is the danger? I gotta hear this...

I'll tell you what's dangerous
It's pretty scary to think that some wacko over at "National Geographic" would even consider giving one ounce of credibility to the mental midget who came to the conclusion that chimpanzees are in the same boat as humans.

"Planet of the Apes" was and always will be pure fiction, pal!

The logic of evolutionism and belief we are descendants of other kinds of creatures leads to this absurdity of delcaring chimps to be human. It will now lead to lawyers arguing in court for their human rights.

Or it can lead to lawyers arguing for man's chimp-rights, which might turn out to be quite a leap forward for human rights, especially in some states.

...you are worried about how the truth will affect your politics or your faith.

...Umm...OK...(slowly backing out the nearest door)....

[Studies indicate that humans and chimps are between 95 and 98.5 percent genetically identical.]

This is a nonsense.

You're welcome to present your own DNA studies which show anything to the contrary. Oh, right, you don't have any.

As someone said: "Nearly 75% of human genes have some counterpart in nematodes--a soil-dwelling worm that is about four thousandths of an inch long. Does that mean that a nematode is 75% human?"

No, because you've obviously pulled a dishonest bait-and-switch. The original statement was that Chimp and Human DNA was 98+% *IDENTICAL*. And it is.

Suddenly, you're talking about only having "some counterpart", which is a *much* broader type of comparison. Furthermore, your creationist source has further stretched the comparison... While the human/chimp comparison is across the *entire* genome, the alleged "75%" comparable human/nematode comparison is only that "Of the 5000 best known human genes, three fourths have close analogues in the nematode." (Note that 5000 human genes is only 6% of the *total* number of human genes.) So only a *partial* comparison of "close analogues" turns up 75% "similarity" (not 75% exact match). Also note that the "best known" human genes are quite commonly the ones that run the basic cellular machinery, which *would* be more likely to be shared in at least some form with other multi-celled animals -- the genes that make us more uniquely human are mostly still in the territory of "unknown" genes.

To further demonstrate the dishonesty of the implied "75% same" claim, note that the nematode DNA has only 97 million base pairs of DNA, compared to 3,000+ million base pairs for humans. Human DNA has over THIRTY TIMES THE VOLUME of information as the nematode DNA. Even if *every* nematode DNA sequence matched *exactly* a human DNA sequence (and they sure as hell don't), that would at *MOST* make for only a 3.2% human/nematode DNA match. And that's the *absolute maximum* amount of match that could *possibly* exist, since the entire nematode DNA is only 3.2% as large as the human DNA. Your creationist source sort of "forgot" to point that out, didn't it?

When are you folks going to stop believing what creationist sources try to mislead you into believing about science?

To further underscore the dishonest implications of the creationist claims, let's look at one of the "similar" genes, shall we? The following is an actual comparison between a gene in nematodes (top line, UNC-76) and the homologous gene in humans (bottom two lines, FEZ1 & FEZ2):

Note that even what the creationist source tries to imply as one of the "gene matches" is actually vastly different when you look at the actual amino acid sequences. Not only are there dozens of mismatched amino acides, but the sequences are differing lengths, and there are many insertion/deletion differences (marked by the dashed lines to stretch one sequence to match up with the other).

(The above is from The Caenorhabditis elegans gene unc-76 and its human homologs define a new gene family involved in axonal outgrowth and fasciculation)

So, rather than "75% the same", what we *really* find when we compare nematode DNA versus human DNA is that when you look at only the best known 6% of human genes (which are mostly regulatory and likely to be found in many creatures), about 75% of them can be matched to *some* superficially similar gene in a nematode, even though the "matches" show gross differences in length, encoding, and sequences which are present in one but not the other (and vice versa), making for a "half match" at best. By my math that's a 2.25% overall "match" at best.

Human/Chimp comparisons of similar genes, on the other hand, show far tinier differences -- in keeping with the 98+% similarity. For example, check out this comparison of human/chimp/gorilla/orangutan CHRM2 gene for muscarinic acetylcholine receptor m2. The human gene sequence is on the top 2 lines (from 2 different gene sequencing projects), the following lines are for the other primates. A "." indicates an identical match, a letter indicates a differing base pair.

seq id  sequence name
-----------------------------
     1  human (M16404 in Database) - local file -     
     2  human (SN; AB041391 determined by Silver Project) - local file -      
     3  chimpanzee (220; AB041392 determined by Silver Project) - local file -          
     4  gorilla (U1; AB041393 determined by Silver Project) - local file -         
     5  orangutan (U1; AB041394 determined by Silver Project) - local file -           

nucleotides 1 - 60
   1 ttgtcctggtggctggatccctcagtttggtgaccattatcgggaacatcctagtcatgg
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 61 - 120
   1 tttccattaaagtcaaccgccacctccagaccgtcaacaattactttttattcagcttgg
   2 ............................................................
   3 ............................................................
   4 .................................................g..........
   5 ...............................t.................g..........
     -------------------------------+-----------------+----------
nucleotides 121 - 180
   1 cctgtgctgaccttatcataggtgttttctccatgaacttgtacaccctctacactgtga
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 181 - 240
   1 ttggttactggcctttgggacctgtggtgtgtgacctttggctagccctggactatgtgg
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 .........................t..................................
     -------------------------+----------------------------------
nucleotides 241 - 300
   1 tcagcaatgcctcagttatgaatctgctcatcatcagctttgacaggtacttctgtgtca
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 .............g..............................................
     -------------+----------------------------------------------
nucleotides 301 - 360
   1 caaaacctctgacctacccagtcaagcggaccacaaaaatggcaggtatgatgattgcag
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 361 - 420
   1 ctgcctgggtcctctctttcatcctctgggctccagccattctcttctggcagttcattg
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 421 - 480
   1 taggggtgagaactgtggaggatggggagtgctacattcagtttttttccaatgctgctg
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 481 - 540
   1 tcacctttggtacggctattgcagccttctatttgccagtgatcatcatgactgtgctat
   2 ............................................................
   3 ............................................................
   4 ................c...........................................
   5 ................c.........................................g.
     ----------------+-----------------------------------------+-
nucleotides 541 - 600
   1 attggcacatatcccgagccagcaagagcaggataaagaaggacaagaaggagcctgttg
   2 ............................................................
   3 .................................................a..........
   4 ............................................................
   5 .c..........................................................
     -+-----------------------------------------------+----------
nucleotides 601 - 660
   1 ccaaccaagaccccgtttctccaagtctggtacaaggaaggatagtgaagccaaacaata
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 661 - 720
   1 acaacatgcccagcagtgacgatggcctggagcacaacaaaatccagaatggcaaagccc
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 721 - 780
   1 ccagggatcctgtgactgaaaactgtgttcagggagaggagaaggagagctccaatgact
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ....a................................a......................
     ----+--------------------------------+----------------------
nucleotides 781 - 840
   1 ccacctcagtcagtgctgttgcctctaatatgagagatgatgaaataacccaggatgaaa
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ........................................c...................
     ----------------------------------------+-------------------
nucleotides 841 - 900
   1 acacagtttccacttccctgggccattccaaagatgagaactctaagcaaacatgcatca
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 .......c................................t...................
     -------+--------------------------------+-------------------
nucleotides 901 - 960
   1 gaattggcaccaagaccccaaaaagtgactcatgtaccccaactaataccaccgtggagg
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ...................c....t.............t.....................
     -------------------+----+-------------+---------------------
nucleotides 961 - 1020
   1 tagtggggtcttcaggtcagaatggagatgaaaagcagaatattgtagcccgcaagattg
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 .......a....................................................
     -------+----------------------------------------------------
nucleotides 1021 - 1080
   1 tgaagatgactaagcagcctgcaaaaaagaagcctcctccttcccgggaaaagaaagtca
   2 ............................................................
   3 ............................................................
   4 ................n...........................................
   5 ............................................................
     ----------------+-------------------------------------------
nucleotides 1081 - 1140
   1 ccaggacaatcttggctattctgttggctttcatcatcacttgggccccatacaatgtca
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 1141 - 1200
   1 tggtgctcattaacaccttttgtgcaccttgcatccccaacactgtgtggacaattggtt
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 1201 - 1260
   1 actggctttgttacatcaacagcactatcaaccctgcctgctatgcactttgcaatgcca
   2 ............................................................
   3 ....................................................t.......
   4 ....................................................t.......
   5 ....................................................t.......
     ----------------------------------------------------+-------
nucleotides 1261 - 1320
   1 ccttcaagaagacctttaaacaccttctcatgtgtcattataagaacataggcgctacaa
   2 ............................................................
   3 ............................................................
   4 ............................................................
   5 ............................................................
     ------------------------------------------------------------
nucleotides 1321 - 1332
   1 ggtaaaa-----
   2 ............
   3 .......tatct
   4 ............
   5 ............
     -------+++++

Note the *huge* stretches of hundreds of absolutely *identical* basepairs. The chimp gene differs from the human gene by only *TWO* base pairs out of 1327 base pairs (plus 5 base-pairs of probable "junk" on the end, genes often have "fuzz" on either end, but even 7 out of 1332 bp differences is only 0.5% difference, or 99.5% similarity). Note also that the gorilla gene differs more from the the human DNA than does the chimp, and the orangutan even moreso. This implies a "family tree" of:

                0
            1 +--- 1 humDB
          +---| 0
        2 |   +--- 2 humSN
      +---|   1
      |   +------- 3 chi220
  +---|     0
  |   +----------- 4 gorU1
  |       14
  +--------------- 5 oranU1

So let's not have any more creationist obfuscation about how nematodes are "almost" as similar to humans as chimps are, okay?

And the next time you want to present what you think are scientific facts, try getting them from science sources instead of creationist sources.

There is a misleading and prevailing misconception that each organism or a cell develops out of DNA.

It does.

It never happens, during the division of already existing cell the DNA gets replicated and inherited by each cell to be used as a library of genes.

Yes, exactly. And the additional "cell machinery" for the doubled cell is built via instructions from the DNA (both nuclear and mitochondrial).

During the seuxal reproduction, DNA gets recombinated inside of already existing cells.

Yes, so?

Very different species can use even the same library in a different way and order.

You are invited to document this amazing claim.

I fell on the floor laughing as I read your post!!

If that is the scariest thing you read on this thread before you left, you might get out intact.

Poor baby, science hits you right in the faith again.

Chimps using vacuums and microwaves is not the point. How many of these appliances did they invent? (Al Gore excluded).

At what point along the evo'n path did consciousness (or a soul) evolve?

Why has no one posted any 'Planet of the Apes' pix yet?

And your point is what?

Ever heard of the Phrase, we don't know?

You might try it on, it works REAL well.

It's a truthful statement, with no arrogance attached to it at all.

OK, fine. Fire union workers and put 'em on the assembly line.

They may not work for peanuts, but they will work for bananas.

You don't see the danger in this?

What next, chimps will have the same rights as humans? A right to a lawyer, a right to sue?

Equating animal life with human life isn't elevating an animal, it's tearing down humans.

I fell on the floor laughing as I read your post!!

I hope you didn't hurt...aw who cares, you can be replaced--by a chimp!

If you want an argument why evo'n is possibly false, try answering my post 68 on the thread about Mosquitoes becoming tolerant of pesticides.

WHAT IS HOMO?