Replies

1 posted on 07/05/2010 5:25:26 PM PDT by decimon

To: neverdem; DvdMom; grey_whiskers; SunkenCiv

First in, last out ping.

2 posted on 07/05/2010 5:26:39 PM PDT by decimon

To: SunkenCiv

pingling

3 posted on 07/05/2010 6:48:35 PM PDT by tutstar (Baptist Ping List-freepmail me to be included or removed. <{{{><)

To: decimon

Holy bat guano, are they saying we could catch a hemorrhagic virus from these critters? Guess its time to put Rocko down!

4 posted on 07/05/2010 7:10:03 PM PDT by nomad

To: decimon

About 8 % of the human genome is fossils of viruses. http://en.wikipedia.org/wiki/Endogenous_retrovirus

10 posted on 07/05/2010 10:52:08 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: decimon

The Jonas Strain

16 posted on 07/07/2010 12:53:47 PM PDT by rintense

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794