Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: allmendream
The fact that this RNA mechanism can act as a transcription factor IS a supporting data point for the “RNA world” hypothesis, because something like this would need to exist in order for there to be any sort of a complex 'all RNA' replicator.

Yes.
11 posted on 08/13/2010 7:14:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies ]


To: AdmSmith
The pieces of the puzzle just seem to keep falling into place. RNA enzymatic action, the intermediary between DNA and functional proteins, and now transcription control. What next?
12 posted on 08/13/2010 7:29:07 AM PDT by allmendream (Income is EARNED not distributed. So how could it be re-distributed?)
[ Post Reply | Private Reply | To 11 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson