To: allmendream
The fact that this RNA mechanism can act as a transcription factor IS a supporting data point for the RNA world hypothesis, because something like this would need to exist in order for there to be any sort of a complex 'all RNA' replicator.
Yes.
11 posted on
08/13/2010 7:14:50 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: AdmSmith
The pieces of the puzzle just seem to keep falling into place. RNA enzymatic action, the intermediary between DNA and functional proteins, and now transcription control. What next?
12 posted on
08/13/2010 7:29:07 AM PDT by
allmendream
(Income is EARNED not distributed. So how could it be re-distributed?)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson