Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 05/10/2016 10:59:44 PM PDT by nickcarraway
[ Post Reply | Private Reply | View Replies ]


To: nickcarraway

Wasn’t there some horrible SNL skit where Chris Kattan (probably the most execrable SNL alum of all time) played a character called goatboy?


2 posted on 05/10/2016 11:02:18 PM PDT by who_would_fardels_bear
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Slings and Arrows

Behind every screaming goat is a happy Muslim ping.


3 posted on 05/10/2016 11:02:21 PM PDT by To Hell With Poverty (Those who make peaceful revolution impossible will make violent revolution inevitable. ~ JFK ~)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway
"He said research would be conducted on the kid's carcass to find out the reasons behind its human-looking features.

"This included investigating the possibility that the mother goat was violated by a human, he said."


4 posted on 05/10/2016 11:03:25 PM PDT by Pelham (Trump/Tsoukalos 2016 - vote the great hair ticket)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

That kind of love is not in the Bible!


7 posted on 05/10/2016 11:08:08 PM PDT by WMarshal (Trump 2016)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

12 posted on 05/10/2016 11:22:14 PM PDT by Wilderness Conservative
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

This disorder is caused by the nanny consuming the plants of the Veratrum family (Hellebore) early during her pregnancy. Ewes are also sensitive. The stage of pregnancy when the plant is consumed determines the nature of deformity, but generally the kids or lambs are born dead or die shortly after. If the plant is eaten late, the offspring grow too large to birth and the mothers die horrible deaths. This is tragic for animals and herdsmen alike.


13 posted on 05/10/2016 11:34:11 PM PDT by stormer
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway
This included investigating the possibility that the mother goat was violated by a human, he said.

What a moron.

14 posted on 05/10/2016 11:42:25 PM PDT by Jeff Chandler (Everywhere is freaks and hairies Dykes and fairies, tell me where is sanity?)
[ Post Reply | Private Reply | To 1 | View Replies ]

Junk science.


15 posted on 05/10/2016 11:43:54 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

Found in the Middle East right?


16 posted on 05/11/2016 12:13:01 AM PDT by jsanders2001
[ Post Reply | Private Reply | To 1 | View Replies ]

To: goat granny
That's a stabbin'
17 posted on 05/11/2016 12:30:23 AM PDT by Daffynition ("We have the fight of our lives coming up to save our nation!" ~ Jim Robinson)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

Only if you consider mooseSlimes to be human.


19 posted on 05/11/2016 1:50:04 AM PDT by rawcatslyentist (Genesis 1:29 And God said, Behold, I have given you every herb bearing seed,)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

“Johor to Test if Human-Looking Goat Is Offspring of Human and Animal”

No testing is necessary. Stupid muslims should open a freaking biology book.


22 posted on 05/11/2016 3:19:25 AM PDT by Brooklyn Attitude (It's the apocalypse, lets have some fun!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

Baaaaaaaaaaaa-lahu Aaaaaaaaackbar.


25 posted on 05/11/2016 3:35:17 AM PDT by 60Gunner (The price of apathy towards public affairs is to be ruled by evil men. - Plato)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

So who do you honor kill? The goat or the human?


26 posted on 05/11/2016 4:48:46 AM PDT by DannyTN
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

The Orson Wells movie “The island of Moriow” (the name ecsapes me) comes to mind...


27 posted on 05/11/2016 4:55:41 AM PDT by Popman (Christ alone: My Cornerstone...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

Whatever it is isn’t Halal.


29 posted on 05/11/2016 4:58:41 AM PDT by Dr. Sivana ("There is no limit to the amount of good you can do if you don't care who gets the credit."-R.Reagan)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway
This included investigating the possibility that the mother goat was violated by a human, he said.

Whoa! Hey Now, who are you to judge and impose your views of morality on this loving couple? You're just prejudiced against interspecies love and trying to shove your outdated religious beliefs down their throats. What two consenting mammals do within a loving relationship is none of your concern, they should have the same rights, including the right to marry as any other couple. /sarcasm (but I wouldn't put it past a liberal to actually make that argument)

32 posted on 05/11/2016 5:56:07 AM PDT by apillar
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

That is impossible, not even compatible number of chromosomes 69 vs 46 https://en.wikipedia.org/wiki/List_of_organisms_by_chromosome_count (among other things)


36 posted on 05/11/2016 12:20:06 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

So just WAS Ibrahim Basir of Felda Sungai Mas doing around the goat pen in the middle of the night?


39 posted on 05/11/2016 12:39:14 PM PDT by Alas Babylon!
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

41 posted on 05/11/2016 9:16:50 PM PDT by dfwgator
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson