Free Republic
Browse · Search
News/Activism
Topics · Post Article

Flashback:

Former Senator Says 9/11 Commission Report Implicates Saudis
http://www.thenewamerican.com/usnews/foreign-policy/item/22982-former-senator-says-911-commission-report-implicates-saudis

Massaoui Statement Renews Suspicions of Saudi Involvement in 9/11 Attacks
http://www.thenewamerican.com/world-news/item/20056-massaoui-statement-renews-suspicions-of-saudi-involvement-in-9-11

Rand Paul Urges Publication of Redacted Portion of 9/11 Report
http://www.thenewamerican.com/usnews/congress/item/20989-rand-paul-urges-publication-of-redacted-portion-of-9-11-report

1 posted on 04/16/2016 4:44:08 AM PDT by VitacoreVision
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-24 next last
To: VitacoreVision

2 posted on 04/16/2016 4:48:25 AM PDT by Travis McGee (www.EnemiesForeignAndDomestic.com)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

Ask Donald what to do. Saudis will not intimidate him.


4 posted on 04/16/2016 4:58:24 AM PDT by amihow (lT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

News flash - We don't need your f*cking oil anymore. Go eat sand.


7 posted on 04/16/2016 5:15:40 AM PDT by Dilbert56
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

It’s way passed time to disclose this information to the American people!


8 posted on 04/16/2016 5:16:36 AM PDT by Faith65 (Isaiah 40:31)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

Freeze their assets now...then pass the law. The barbarians have been screwing US for decades.


9 posted on 04/16/2016 5:17:00 AM PDT by RouxStir (No peein' allowed in the gene pool.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

Wonder if congress will do what is right, or will they begin to dance with the devil?


10 posted on 04/16/2016 5:20:39 AM PDT by MeneMeneTekelUpharsin (Freedom is the freedom to discipline yourself so that others don't have to do it for you.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision


17 posted on 04/16/2016 5:45:40 AM PDT by JoeProBono (SOME IMAGES MAY BE DISTURBING ’VIEWER DISCRETION IS ADVISED;-{)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

This is when I wish Trump was already President.


18 posted on 04/16/2016 5:46:44 AM PDT by exit82 ("The Taliban is on the inside of the building" E. Nordstrom 10-10-12)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision
Maybe I'm missing something here ...

If a U.S. court of law determines that Saudi Arabia had any involvement in 9/11 and awards monetary damages to any Americans in the process, doesn't this mean George W. Bush and a bunch of people from his administration ... along with most members of Congress at the time ... along with all of the same people in the Clinton and first Bush administrations ... should be on trial for war crimes?

Wouldn't a court decision like this be a formal admission that the U.S. was on the wrong side all the way back in 1990?

19 posted on 04/16/2016 5:49:01 AM PDT by Alberta's Child ("Sometimes I feel like I've been tied to the whipping post.")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

I'm sure Obama will really let the Saudi's have it.

21 posted on 04/16/2016 5:52:29 AM PDT by bk1000 (A clear conscience is a sure sign of a poor memory)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision
"Saudi Arabia has told the Obama administration and members of Congress that it will sell off hundreds of billions of dollars’ worth of American assets held by the kingdom if Congress passes a bill that would allow the Saudi government to be held responsible in American courts for any role in the Sept. 11, 2001, attacks."

This one sentence totally explains the corruption of western politics and media.

23 posted on 04/16/2016 5:54:34 AM PDT by fella ("As it was before Noah so shall it be again,")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

Nullify the value of the securities and bonds in the same bill.


26 posted on 04/16/2016 5:57:37 AM PDT by Bobalu (I'm spitting on my hands, and hoisting the black flag!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision; SunkenCiv

Too many people have read it so the document is practically in the public domain already.

http://www.thenewamerican.com/usnews/foreign-policy/item/22982-former-senator-says-911-commission-report-implicates-saudis

Furthermore, the 9/11 Commission should have asked Fort Meade: Do you have any other info that is relevant?


29 posted on 04/16/2016 6:03:18 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

Sell them to the Chinese....


30 posted on 04/16/2016 6:05:07 AM PDT by central_va (I won't be reconstructed and I do not give a damn.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

imam zero will never allow it. pass the bill for president Trump to sign into law.


32 posted on 04/16/2016 6:10:20 AM PDT by HWGruene (REMEMBER THE ALAMO! Really, no kidding.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

they better sell it off as they will be sued for it all.


34 posted on 04/16/2016 6:11:36 AM PDT by HWGruene (REMEMBER THE ALAMO! Really, no kidding.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

It is really time to cut the cord with this despicable regime, and its repulsive Wahabbism.


35 posted on 04/16/2016 6:25:02 AM PDT by yefragetuwrabrumuy ("Don't compare me to the almighty, compare me to the alternative." -Obama, 09-24-11)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

The bill is an anomaly in a Congress fractured by bitter partisanship, especially during an election year. It is sponsored by Senator John Cornyn, Republican of Texas, and Senator Chuck Schumer, Democrat of New York. It has the support of an unlikely coalition of liberal and conservative senators, including Al Franken, Democrat of Minnesota, and Ted Cruz, Republican of Texas. It passed through the Judiciary Committee in January without dissent.


from the article.


37 posted on 04/16/2016 6:37:42 AM PDT by PeterPrinciple (Thinking Caps are no longer being issued but there must be a warehouse full of them somewhere.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

Helps one to understand the excessive influence Saudi Arabia has on our government.


45 posted on 04/16/2016 7:20:20 AM PDT by I want the USA back (The further a society drifts from the truth, the more it will hate those who speak it. Orwell.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: VitacoreVision

The Saudis can threaten to sell off billions of US assets, but they could take a serious loss if they do. I heard they were having financial problems. If so, a big sell off wont help.

Too, after selling off what I would assume are good assets generating a reasonable or better return on investment, where will they invest these billions to get a comparable, equally safe ROI? A solid portfolio is hard to replace. My guess is that there are not a lot of highly profitable, safe investment opportunities in the world just waiting for investment at rock bottom prices.

Perhaps they can invest in Venezuela or Cuba. Zimbabwe is begging for investment. There is always Communist China. Maybe buy up a bunch of EU windmills or any investment in Russia.


46 posted on 04/16/2016 7:24:07 AM PDT by Mister Da (The mark of a wise man is not what he knows, but what he knows he doesn't know!)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-24 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson