Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The coronavirus could cripple China's economy for longer than Wall Street wants to believe
Business Insider ^ | 16 Feb 2020 | Linette Lopez

Posted on 02/16/2020 6:53:01 PM PST by BeauBo

Wall Street is convincing itself that China will bounce back relatively quickly around the end of the first quarter, when it expects the coronavirus' spread to be contained.

This is banker delusion. China's economy is growing much more slowly than it was in 2003, when the SARS outbreak hit.

Plus, the financial sector is in much worse shape. It's loaded with debt, and credit conditions are still deteriorating from bailouts last year. This will all make it much harder to fund struggling businesses and local governments.

(Excerpt) Read more at businessinsider.com ...


TOPICS: Business/Economy; Foreign Affairs; News/Current Events
KEYWORDS: coronavirus; covid19
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081 next last
To: BeauBo

MAYBE, just MAYBE, this will be the catalyst that severs our DEPENDENCY with Chinas CHEAPY and CREEPY CRAP.


61 posted on 02/17/2020 3:02:06 AM PST by Ann Archy (Abortion....... The HUMAN Sacrifice to the god of Convenience.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BushCountry

Thanks for the positive info.


62 posted on 02/17/2020 3:15:51 AM PST by MeneMeneTekelUpharsin (Freedom is the freedom to discipline yourself so others don't have to do it for you.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Rebelbase

ROFL.


63 posted on 02/17/2020 3:16:37 AM PST by MeneMeneTekelUpharsin (Freedom is the freedom to discipline yourself so others don't have to do it for you.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: ProtectOurFreedom

“Still, 200 million is nothing to sneeze at.”

So to speak.


64 posted on 02/17/2020 3:29:39 AM PST by 21twelve (Ever Vigilant. Never Fearful.)
[ Post Reply | Private Reply | To 56 | View Replies]

To: MeneMeneTekelUpharsin

Meanwhile, commie Xi is using this crisis as an opportunity to further crack down on dissidents.

https://www.scmp.com/news/china/politics/article/3051000/chinese-police-detain-fugitive-rights-activist-xu-zhiyong


65 posted on 02/17/2020 3:30:35 AM PST by littleharbour ("You take on the intel community they have six ways from Sunday at getting back at you" C. Schumer)
[ Post Reply | Private Reply | To 63 | View Replies]

To: bigbob

If we learn from this.

I have been saying for years we need to re-localize much of our economy, especially away from China—starting with meds, supplements and food.


66 posted on 02/17/2020 3:43:35 AM PST by 9YearLurker
[ Post Reply | Private Reply | To 46 | View Replies]

To: 9YearLurker

I was going to say to diversify locations - what if some virus is strong in the USA but is absent somewhere else?

I guess if there is true competition in the global economy, that will happen naturally. (France, China, Japan, etc. would all be making stuff).

But with China, when the government helps their companies, they have such an unfair advantage that they can take in 90+% of production of some items.


67 posted on 02/17/2020 3:52:18 AM PST by 21twelve (Ever Vigilant. Never Fearful.)
[ Post Reply | Private Reply | To 66 | View Replies]

To: 21twelve

It’s still better for us to do more and be more self-sufficient here. Less waste and pollution with freight shipping. More biodiversity in agriculture. More security in times of emergency and flexibility in changing our own production as needed. And more low to moderate skill jobs for all lower-skill Americans we’ve created through our bad immigration policies of the last half century.


68 posted on 02/17/2020 3:55:56 AM PST by 9YearLurker
[ Post Reply | Private Reply | To 67 | View Replies]

To: BeauBo

Short Walmart.

ymmv.


69 posted on 02/17/2020 3:59:34 AM PST by mad_as_he$$
[ Post Reply | Private Reply | To 1 | View Replies]

To: huckfillary

In the News/Activism forum, on a thread titled The coronavirus could cripple China’s economy for longer than Wall Street wants to believe, huckfillary wrote: “When are they going to simply embrace free-market capitalism? What does anyone get out of tyranny? What’s the payoff?”

Undeserved power and control.


70 posted on 02/17/2020 4:28:51 AM PST by BTerclinger (MAGA)
[ Post Reply | Private Reply | To 5 | View Replies]

To: BeauBo

Wish we could hack the chicomm grid and spread this message: the only cure for Corona virus is in the boiled blood of the the chicomm


71 posted on 02/17/2020 4:30:34 AM PST by BTerclinger (MAGA)
[ Post Reply | Private Reply | To 1 | View Replies]

To: huckfillary

The rulers get quite a lot out of tyranny. And frankly, when you look at evidence of the degeneracy of the west, where people can self-identify as one of millions of different made-up genders and be taken seriously and where people who mean serious harm to society are treated more like victims by large and powerful sections of our ‘open society’ and not clamped down upon as they are in China, I think the question is ‘what is the west getting out of freedom and free market capitalism’?


72 posted on 02/17/2020 5:09:08 AM PST by sinsofsolarempirefan
[ Post Reply | Private Reply | To 5 | View Replies]

To: Hillarys Gate Cult

73 posted on 02/17/2020 5:43:01 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 6 | View Replies]

To: marktwain

and avian flu killing off chickens


74 posted on 02/17/2020 5:45:28 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 29 | View Replies]

To: BushCountry

not working in Singapore - virus likes heat as may be bioweapon


75 posted on 02/17/2020 5:47:27 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 30 | View Replies]

To: daniel1212

the chinese have historic hatred of japanese made worse by their murder of 20m japs in wwii


76 posted on 02/17/2020 5:49:51 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 37 | View Replies]

To: mrsmith

ships that should have sailed 2 weeks ago haven’t; ships that should sail now are not loaded; goods that were to be on those ships are not made; goods that would be made for ships sailing mar 1 are waiting for factories to reopen; workers that made those goods for the factory that is not open are sick dying dead; holding breath is not a viable option


77 posted on 02/17/2020 5:57:00 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16 | View Replies]

To: SecondAmendment

Since china took over the biggest junk of our Pharmaceuticals how does it effect that. Great for us who are taking their Cancer causing drugs. The 2 big ones Metformin and BP meds. Zantac has a lot of replacements.

FDA sent out the warning on Metformin, but didn’t warn the Endo’s. Saw mine 5 days ago, slow Digestive...Gastropresis causes you to become a diabetic. I’d been expecting it for the last yr. Januvia is not working because I can’t change diets that arre polar opposites, no middle ground.

He who forgets history is doomed to repeat it, never let your control of industry out of your country.


78 posted on 02/17/2020 6:30:59 AM PST by GailA (Intractable Pain, a Subset of Chronic pain Last a Life TIME at Level 10.)
[ Post Reply | Private Reply | To 19 | View Replies]

To: BeauBo; nuconvert; SunkenCiv

The American Chamber of Commerce in Shanghai has just conducted a survey of member companies with manufacturing operations in Shanghai, Suzhou, Nanjing and the wider Yangtze River Delta. The survey was in the field from February 11-14 with 109 members responding.

The purpose of the survey is to provide a clear picture of the operating environment as companies begin to re-open. In addition, AmCham was seeking to provide helpful feedback to the local and provincial government on the re-opening process.

Survey Highlights

48% of companies report their global operations are already impacted by the shutdown

78% of companies do not have sufficient staff to run a full production line

41% of companies say a lack of staff is their biggest challenge in the next 2-4 weeks; 30% of companies say logistics issues will be their biggest concern

Over the next few months, 58% of companies expect demand for their output to be lower than normal

38% of companies do not have sufficient masks/other supplies to protect their staff from coronavirus infection

35% of companies ranked a clearer explanation of requirements as the most important thing government officials could do to speed up factory opening approvals

https://www.amcham-shanghai.org/en/article/supply-chains-and-factory-openings-amcham-shanghai-mini-survey


79 posted on 02/17/2020 6:31:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Interesting. Thanks


80 posted on 02/17/2020 6:53:47 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 79 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson