Free Republic
Browse · Search
Religion
Topics · Post Article


1 posted on 05/27/2023 1:59:31 AM PDT by spirited irish
[ Post Reply | Private Reply | View Replies ]


To: metmom; sauropod; ViLaLuz

ping to quiet apocalypse


2 posted on 05/27/2023 2:06:06 AM PDT by spirited irish ( )
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

To explain anything, just follow the money. The socialists removed the return on investment for raising children, replacing it with big government programs like the Socialist Security System. Now the bureaucratic empire takes care of you in old age, until they don’t.


3 posted on 05/27/2023 2:24:23 AM PDT by Reeses
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

This is one of a number of reasons I rep eatedly point out that Demographics is Destiny.


5 posted on 05/27/2023 2:37:16 AM PDT by MachIV
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

There ARE benefits to this world-wide decline.


7 posted on 05/27/2023 2:48:10 AM PDT by Adder (ALL Democrats are the enemy. NO QUARTER!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

Miscarriages and sterilization via the JAB?


10 posted on 05/27/2023 3:17:58 AM PDT by stars & stripes forever (Blessed is the nation whose GOD is the LORD? (Psalm 33:12))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

There is a perfect demonic storm on the horizon that makes the depopulation lunatics like Gates giddy. The typical trends of delayed child rearing and low numbers of children below the required replacement rate have been around for years, but now there are more destructive forces at work. The most alarming is the use of the mRNA vax which may permanently disrupt the normal function of the reproductive systems in males and females. Then we have transgenderism at work deliberately and irreversibly destroying the reproductive organs of a portion of the young generation. The combination portends for a sharp population fall-off.


13 posted on 05/27/2023 3:34:52 AM PDT by iontheball
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

Only white people are not having children. Dark skinned people around the world are having plenty.


14 posted on 05/27/2023 3:38:19 AM PDT by joma89 (Buy weapons and ammo, folks, and have the will to use them.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: All

It took decades of “over population” propaganda to convince people to not have kids.
It will probably take decades to reverse that. At least admitting its a problem is a good start but importing 3rd worlders will make a society where people DON’T want to raise their children.
(plus constant promotion of sex perverts can’t help either)


15 posted on 05/27/2023 3:39:15 AM PDT by escapefromboston (Peace, commerce and honest friendship with all nations, entangling alliances with none.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

“Children of Men” (2006)
https://www.youtube.com/watch?v=2VT2apoX90o&ab_channel=RottenTomatoesClassicTrailers


19 posted on 05/27/2023 5:00:19 AM PDT by Tom Tetroxide
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

Not a problem. Many babies are popping outta the womb, even as we speak. Unfortunately, they all speak Spanish.


21 posted on 05/27/2023 7:22:35 AM PDT by moovova ("The NEXT election is the most important election of our lifetimes!“ LOL...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish; metmom; sauropod; ViLaLuz; Reeses; MachIV; stars & stripes forever; nuconvert; ...
The Russian solution: Tax couple without children

Putin made a decision on the childlessness tax and put forward an important condition.

According to our sources in the Kremlin and the government, the president approved the introduction of a childlessness tax in Russia. And its rate - as we wrote, the new tax will be set at 9% of the income of childless citizens.

At the same time, Vladimir Putin put forward a condition for introducing a new tax: he gave the task of working out a mechanism in which at least 60-70% of the proceeds from it would go to help veterans of the Northern Military District. In particular, he instructed to consider the possibility of payments to veterans who will start families. The remaining funds received from the new tax are planned to be spent on helping large families and anti-abortion campaigns.

Now two questions remain to be resolved: at what age will childless citizens pay the tax and when will it be introduced. These issues are being studied.

It is expected that, as we predicted , the childlessness tax will be introduced in the summer.

https://t.me/kremlin_secrets/3859

Why not better support for having children?

26 posted on 03/31/2024 8:20:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

Not so with the Muslims.


27 posted on 03/31/2024 8:22:45 AM PDT by kenmcg (ti hi o)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: spirited irish

“The scenario is – perhaps without exaggeration – quietly apocalyptic.”

Wait - I thought the “population explosion” was going to be the death of us. I guess that was back in the days of global cooling.

Tomorrow’s headline: “Global Warming linked to decreased sperm counts and historic childlessness.”


29 posted on 04/01/2024 1:38:56 AM PDT by 21twelve (Ever Vigilant. Never Fearful.)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
Religion
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson