To: lurk
“Isnt the correct term adaptation, not evolution?”
I don't know the scientific difference and think evolution is continual adaptation.
11 posted on
04/09/2011 9:31:44 AM PDT by
balls
(0 lies like a Muslim (Google "taqiyya"))
To: balls
The controversy over Evolution is centered around the idea that one species might evolve into a different species. Down that road, we would need to see a creature from one genus evolve into a different genus. One class evolve into a different class. These are monumental changes and nothing of the sort has ever been demonstrated.
When we see adaptation within a single species, we shrug and say, So What? This is not the same thing as saying everything started from a single-celled lifeform.
Adaptation is boring and proves nothing at all.
To: balls; lurk
Well, I always thought that one pretty good definition of evolution was change in gene frequency. Speciation occurs when populations or sub-populations are isolated (genetically) from their sisters and brothers over a long period of time.
Thanks for posting...interesting.
14 posted on
04/09/2011 9:40:10 AM PDT by
Pharmboy
(What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
To: balls; Pharmboy; Rudder
42 posted on
04/10/2011 6:33:43 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson