Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: lurk
“Isn’t the correct term adaptation, not evolution?”

I don't know the scientific difference and think evolution is continual adaptation.

11 posted on 04/09/2011 9:31:44 AM PDT by balls (0 lies like a Muslim (Google "taqiyya"))
[ Post Reply | Private Reply | To 4 | View Replies ]


To: balls
The controversy over Evolution is centered around the idea that one species might evolve into a different species. Down that road, we would need to see a creature from one genus evolve into a different genus. One class evolve into a different class. These are monumental changes and nothing of the sort has ever been demonstrated.

When we see adaptation within a single species, we shrug and say, So What? This is not the same thing as saying everything started from a single-celled lifeform.

Adaptation is boring and proves nothing at all.

13 posted on 04/09/2011 9:38:46 AM PDT by ClearCase_guy
[ Post Reply | Private Reply | To 11 | View Replies ]

To: balls; lurk
Well, I always thought that one pretty good definition of evolution was change in gene frequency. Speciation occurs when populations or sub-populations are isolated (genetically) from their sisters and brothers over a long period of time.

Thanks for posting...interesting.

14 posted on 04/09/2011 9:40:10 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 11 | View Replies ]

To: balls; Pharmboy; Rudder

http://biology.clc.uc.edu/courses/bio303/coevolution.htm


42 posted on 04/10/2011 6:33:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson