Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: AdmSmith

If the Turks have the video, it is likely that the room that was used is known. It is difficult to get rid of all DNA.


24 posted on 10/08/2018 5:00:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 23 | View Replies ]


To: AdmSmith

Saudi denials – and deflection – of any knowledge of Khashoggi’s whereabouts read from a Kremlin playbook, as does his alleged death.

Turkey, meanwhile – the world’s most prolific jailer of journalists – now finds itself in the peculiar position of being a champion for a columnist who vanished under its nose.
https://www.theguardian.com/world/2018/oct/07/khashoggi-case-against-saudi-agents-reverberates-through-ankara-and-riyadh


25 posted on 10/08/2018 5:16:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 24 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson