Free Republic
Browse · Search
News/Activism
Topics · Post Article

Author has peer reviewed book on the theory that Gobekli Tepe monoliths can be read as representing constellations and the destruction caused by multiple comets hitting Earth memorialized by survivors.
1 posted on 04/16/2019 1:33:13 PM PDT by wildbill
[ Post Reply | Private Reply | View Replies ]


To: wildbill

Too bad the geological record does not record any such event.


2 posted on 04/16/2019 1:35:14 PM PDT by marktwain (President Trump and his supporters are the Resistance. His opponents are the Reactionaries.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Where is the proof?
There should be holes in the ground, burned forests, iridium all over the place................


4 posted on 04/16/2019 1:40:13 PM PDT by Red Badger (We are headed for a Civil War. It won't be nice like the last one....................)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill
Ancient Origiins

Origen is an ancient and rehabilitated heretic.

6 posted on 04/16/2019 1:44:49 PM PDT by arthurus (HoioH)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

That is an interesting article. Thank you.


9 posted on 04/16/2019 1:50:53 PM PDT by GingisK
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Luckily, several species of small fury creatures were gathered in a cave and grooving with a pict ...


11 posted on 04/16/2019 1:57:08 PM PDT by An.American.Expatriate (Here's my strategy on the War against Terrorism: We win, they lose. - with apologies to R.R.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Is this the Younger-Dryas event?


12 posted on 04/16/2019 2:02:43 PM PDT by Rebelbase
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Lol.. peer review said the hymalayas will melt by 2020.


13 posted on 04/16/2019 2:08:26 PM PDT by momincombatboots (Do you know anyone who isnÂ’t a socialist after 65? Freedom exchanged for cash and control.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Carolina Bays and Nebraska Platte River depressions point to Saginaw Bay, Wisconsin as epicenter of one of the impacts. The ice was a mile thick there/then and ejecta was made up of ice.

There’s iridium all over the world at the 13,000 year level of soil.

The Clovis flint knap arrow point making indians all perished at this time.


14 posted on 04/16/2019 2:10:04 PM PDT by cicero2k
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Fascinating.

I’m not saying it was comets, but it was comets.


16 posted on 04/16/2019 2:12:32 PM PDT by Mariner (War Criminal #18)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Ping.


20 posted on 04/16/2019 2:35:17 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

*Three thousand years after it was founded, Gobekli Tepe was purposefully buried to protect its heritage.*

but wait, there’s more: “They reached Britain in about 4,000BC.” and built Stonehenge.

https://www.msn.com/en-us/news/world/dna-reveals-origin-of-stonehenge-builders/ar-BBVZlcw?ocid=spartanntp

Same folk? So maybe not such a slow, quiet demise but more of a hasty, forced exodus?


24 posted on 04/16/2019 3:30:25 PM PDT by blueplum ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Sounds like “Magicians of the Gods” by Graham Hancock which came out several years ago.

There were two strikes 1000 years apart (each was a one mile diameter rock) - the first ended the last ice Age, the second began the Younger Dryas, the coldest recent period.

The asteroids are believed to be the remains of a giant comet which broke up long long before. It is believed that the Earth passes through the dense part of the debris field every so often and receives one mile diameter asteroids (otherwise it just a nice light show). The original excavator (now deceased) believed the carvings indicated future strikes. It is a warning to the future and is why it was buried. We are entering such a period now.


31 posted on 04/16/2019 3:59:48 PM PDT by PIF (They camTo think the choice came down to Gorka/Bannon oe for me and mine ... now it is your turn ...)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Can’t be. There were no suv’s around


32 posted on 04/16/2019 4:02:41 PM PDT by Long Jon No Silver
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

I’ve been following the Gobekli Tepe story for several years now, this is very interesting.


48 posted on 04/17/2019 5:57:28 AM PDT by stockpirate (TYRANNY IS THY NAME REBELLION IS OUR ANSWER. HANG THEM ALL!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill; SunkenCiv; nuconvert

What is Goebekli Tepe | Klaus Schmidt 2014 TED (17 min) https://www.youtube.com/watch?v=a2CDa5zRQR0

Ian Hodder: “Origins of Settled Life; Göbekli and Çatalhöyük” | Talks at Google 2015 (52 min)https://www.youtube.com/watch?v=zKwSg7OyvoE

However:
Archaeologists around the world have been left shocked and furious after the Turkish Culture and Tourism Ministry gave the go ahead for ‘conservation work’ at the ancient site of Göbekli Tepe, which has resulted in irreparable damage from heavy equipment and concrete being poured around the historically important.
https://www.ancient-origins.net/news-history-archaeology/outrage-concrete-poured-world-s-oldest-known-temple-g-bekli-tepe-009802


55 posted on 04/20/2019 12:44:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill

Back in 2012, I was still keeping track of the related topics. From the FRchives:
59 posted on 04/21/2019 5:57:42 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: wildbill
The Younger Dryas Impact Event, postulated here by researchers Ted Bunch, Richard Firestone and Ken Tankersley, may have led to the extinction of large mammals, such as mammoths, saber tooth cats, and 33 other species of large mammal 12,900 in the past. Perhaps more disturbing is the effect the event had on the first inhabitants of America, the so-called Clovis people. The Clovis culture disappears at the same time the animals do. This short excerpt provides some background on this cosmic incident and the evidence supporting it. | Stone Age comet destroys North America | George Howard | Published on May 30, 2008

Stone Age comet destroys North America | George Howard | Published on May 30, 2008

61 posted on 04/21/2019 6:48:07 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson