Posted on 05/01/2006 8:29:14 AM PDT by SirLinksalot
BB & A-G, please read Conservative Texas Mom's # 1161 in this thread.
It appears that, in Conservative Texas Mom, we have another like-minded Believer!
Turn about is fair play.
I'll defer any comments about the primordial soup and certain SABers.
I am an archaeologist. I found a pre-Cambrian hominid.
Get back to me if you are interested.
I contend that you are lying.
Howdy Believer!!!!!!
There was a Tower, somewhere in Babylon.....
Genesis 11
1. Now the whole world had one language and a common speech.
2. As men moved eastward, they found a plain in Shinar and settled there.
3. They said to each other, "Come, let's make bricks and bake them thoroughly." They used brick instead of stone, and tar for mortar.
4. Then they said, "Come, let us build ourselves a city, with a tower that reaches to the heavens, so that we may make a name for ourselves and not be scattered over the face of the whole earth."
5. But the LORD came down to see the city and the tower that the men were building.
6. The LORD said, "If as one people speaking the same language they have begun to do this, then nothing they plan to do will be impossible for them.
7. Come, let us go down and confuse their language so they will not understand each other."
8. So the LORD scattered them from there over all the earth, and they stopped building the city.
9. That is why it was called Babel --because there the LORD confused the language of the whole world. From there the LORD scattered them over the face of the whole earth.
Or an 8 ball.
Butt there may be dingle berries.
I contend AndrewC has a guinea pig living atop his liver.
And frankly, it is rude to keep pursuing this line with someone who is clearly not interested.'
My unsolicited advice to you my dear is to LIVE your faith instead of rudely TALKING it to people who have no desire to speak with you about it.
Thank you for pointing out my rudeness. That's something that we all should learn to over come.....
480 Some bible verses....... by ELSIE
To: ElsieHey Elsie, here's a different kind of text dump. Two stretches of genomes, both from Chromosome 10, one human, one chimp. Which is you and which is the ape?CCAGCGTGCGTGTTCCTGTGCCTGTGGGAG CTGGCTATCTCAGCGGGTGGGTGCCTCACC TTGCCCTGTCCTCCCCCTCGACCTCACTCT CCTTCCTTCTCATCCCCCTCCAGATTGACA AGTATCTCTATGCCATGCGGCTCTCCGATG AAACTCTCATAGATATCATGACTCGCTTCA GGAAGGAGATGAAGAATGGCCTCTCCCGG GATTTTAATCCAACAGCCACAGTCAAGATG TTGCCAACATTCGTAAGGTCCATTCCTGAT GGCTCTGGTCCAGCGTGCGTGTTCCTGTGCCTGTGGGAG CTGGCTATCTTGGCGGGTGGGTGCCTCACC TTGCCCTGTCCTCCCCCTCGACCTCACTCT CCTTCCTTCTCATCCCCCTCCAGATTGACA AGTATCTCTATGCCATGCGGCTCTCCGATG AAACTCTCATAGATATCATGACTCGCTTCA GGAAGGAGATGAAGAATGGCCTCTCCCGG GATTTTAATCCAACAGCCACAGTCAAGATG TTGCCAACATTCGTAAGGTCCATTCCTGAT GGCTCTGGTGo ahead. It's really easy.
506 posted on 05/02/2006 9:17:32 AM CDT by Right Wing ProfessorTo: Right Wing ProfessorText dump? Is that anything like spamming the same stuff over and over?
To: MamzelleIt's exactly like that. Read one of Elsie's quote-mined Biblical regurgitations, and comapre them with other threads' equivalents. You will see the same stuff over, and over, and over...
551 posted on 05/02/2006 11:02:41 AM CDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)To: 2nsdammitYou will see the same stuff over, and over, and over...Yup; you sure will!
I get new folks reading it every thread.
If YOU, however, don't like it; don't read it.
(It does, however, make one wonder just WHY you don't like my posts...)
658 posted on 05/02/2006 2:46:06 PM CDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)To: ElsieI've told you before - because they're annoying, long, quote-mined regurgitations, which contribute nothing.
You sure you're not just a troll?
667 posted on 05/02/2006 2:59:12 PM CDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)To: 2nsdammitYou sure you're not just a troll?Are sure you don't need Jesus as your Savior?
700 posted on 05/02/2006 3:27:45 PM CDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)To: ElsieOops, I was wrong. You're a proselytizing troll.
717 posted on 05/02/2006 3:39:11 PM CDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)To: 2nsdammitOops, I was wrong.See!
That's not so hard, is it? ;^)
1,029 posted on 05/03/2006 7:15:52 AM CDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)To: ElsieNicely removed from context! Your pastor would be proud.... Lies and mischaracterizations just come easy to you, don't they?
For those that don't want to scroll back to my original post from which this was ripped, my statement was:
"Oops, I was wrong. You're a proselytizing troll." (This following on my earlier statement that he was JUST a troll...)
Thanks for proving me correct!
1,060 posted on 05/03/2006 9:29:30 AM CDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)To: 2nsdammitThanks for proving me correct!Are you afraid to say whether you need Jesus as your Savior?
1,139 posted on 05/03/2006 2:39:11 PM CDT by Elsie (Heck is where people, who don't believe in Gosh, think they are not going....)[ To 1060 ]
Groan!
It's his magnetic personality!
I contend Elsie has trilliums growing out of his hair.
"Although its only 4%, a huge DNA chasm separates humans from chimpanzees."
You would think anyone with common sense would see there is a big difference between a human and a chimp. The closeness of DNA further points to a creator of all life.
The only threads on FR that get more cantankerous than these are the men/women bashing ones...
You know, it all starts with an article (usually) pointing out the horrors of feminism, or the divorce system, a few men chime in their 'amens' with horror stories, a few usual suspect women Freepers go ballistic and start men-bashing, and it all goes down from there...
however, though the level of emotion is higher due undoubtedly to personal experience, nothing beats these threads for examples of people shouting past each other...kind of like when I try to discuss politics with my LA cousin...who lives in a parallel (liberal) universe, it would appear...
but the folks on this thread all live in the same universe....its just that some of them have a real problem understanding that:
1. The Bible was not written as a science text;
2. Faith is not science (or vice-versa);
3. People on both sides of this debate who try to disprove the other wind up looking foolish...and lastly,
4. It is impossible to disprove one discipline using the principles from another, wholly unrelated discipline (ie. science vs. Faith and vice-versa)...
just to reiterate the terms:
Given:
1. “might” is defined as ability to impose positive and negative consequences, immunity to reprisals, lack of needs requiring exogenous sources of fulfillment, and endurance.
2. “right” in this application specifically excludes mathematically correct solutions to specific problems, mechanically sound design, etc... we are speaking SOLELY of the form/concept of “right” tied to “morality”
Postulate:
“right” is always defined by might, and that definition's range and power is always proportionate to the might of the one making the definition.
Challenge:
Provide one case where the above is clearly not operant…
*****
I was thinking more along the lines of classical Socratic dialectics, rather than Hegelian or Marxian nonsense.
Aristotle began steeped in agreement with Plato, but his later (and more important) thinking trended heavily towards ever-purer experientialism, the basis of empirical naturalism.
As to your example:
While the Founders did try to set Law apart from the whim of rulers AND the fickle fancy of the mob, they did not divorce the order that document codified from the force and might which makes it possible.
You will note that they created the LEGISLATURE, empowered to inflict various forms of consequence upon the people, and define penalties for disobedience. You will note that they created an EXECUTIVE branch, detailed to enforce the law and punish breakers of that law.
You will also note that the Founders made the Constitution exceedingly durable, very difficult to alter. As stated in the given: endurance. They also made it difficult to remove elected and appointed officials: a high level of immunity from consequence, though not an absolute one. And you will surely be aware of the durability of laws on the books - even long after their supposed purpose is gone, they themselves almost never seem to go away, do they?
The authority of the Constitution and the government it enacts extends only as far as the majority of the populace agrees with it. If sufficient mass of the people came to actively disagree with it, the might of that group would exceed the might of whatever group stood to enforce the Constitution, and the basis of our government would fail.
The real threat to our republic is a slow erosion within the federal capital's culture of the agreement of the officials to abide by constitutional limitations, a slow usurpation of powers, and a slow removal of legal restraints placed upon them. One of the ways they accomplish this is to muddle public understanding of Civics. In earlier times, most Americans had a basic understanding of the denotative meaning of the Constitution, and could accurately judge the words and actions of officials against that template. No longer - the average citizen is so horribly ignorant and so thoroughly trained to wasteful idiosyncracy that they have no real allegiance to the Constitution and no basis from which to judge the lawfulness of their masters.
They divide us into squabbling self-interested factions, lead us to waste our might one against the other, while they remake themselves into nobility, gods on earth, ever mightier, and ever more able to redefine right and wrong to suit their own desires.
It is a classic "boiling the frog" scenario, in which the rulers slowly accumulate more might for themselves, slowly gain ever greater insulation from backlash, and do everything they can to prevent the people from waking up and remembering that, taken together, they themselves are mightier than any ruler.
And this is without question at this time a deliberate process, and has been since at least 1968, probably since at least 1936. Wealth-redistribution (ever-growing imposed consequences: armed robbery and largesse), partisan groupthink indoctrinated into sub-demes throughout public education, and the never-dead campaign to take firearms away from the private citizen. They know right is defined by might, even now, even here.
Try again.
they can say that, and they can demonstrate it.
accuracy and repeatability, RW.
pretty easy to test and verify.
you are questioning a lab technique here, not a theoretical explanation of an ancient one-time biological chain of events.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.