Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

ISIS: The first terror group to build an Islamic state?
CNN ^ | June 12, 2014 | TIm Lister

Posted on 06/12/2014 12:36:27 PM PDT by Mount Athos

The Islamic State in Iraq and Syria has thrived and mutated in the security vacuum that followed the departure of the last U.S. forces from Iraq and the civil war in Syria.

The aim of ISIS is to create an Islamic state across Sunni areas of Iraq and in Syria.

With the seizure of Mosul, Iraq's second-largest city, and advances on others, that aim appears within reach.

ISIS controls hundreds of square miles where state authority has evaporated. It ignores international borders and has a presence all the way from Syria's Mediterranean coast to south of Baghdad.

How to respond to the ISIS threat

What are its origins?

In 2006, al Qaeda in Iraq -- under the ruthless leadership of Abu Musab al-Zarqawi -- terrorized Sunni parts of Iraq as it tried to ignite a sectarian war against the majority Shia community.

It came close to succeeding, especially after the bombing of the Al-Askariya Mosque, an important Shia shrine in Samarra, which sparked retaliatory attacks.

But the killing of al-Zarqawi by American forces, the vicious treatment of civilians by AQI, and the emergence of the Sahwa (Awakening) Fronts under Sunni tribal leaders nearly destroyed the group.

Nearly, but not quite.

When U.S. forces left Iraq, they took much of their intelligence-gathering expertise with them.

Iraqi officials began to speak of a "third generation" of al Qaeda in Iraq.

Two years ago, a former spokesman for the U.S. military in Iraq, Maj. Gen. Jeffrey Buchanan, warned that "if the Iraqi security forces are not able to put pressure on them, they could regenerate."

(Excerpt) Read more at cnn.com ...


TOPICS: Foreign Affairs; News/Current Events; Syria; War on Terror
KEYWORDS: caliphate; iran; iraq; isis; joebiden; johnboehner; kenyanbornmuzzie; ohio; waronterror
Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last

It is not our fault ... https://www.youtube.com/watch?v=-Dp29XacCe8 ... Four Doors


21 posted on 06/12/2014 1:12:29 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 20 | View Replies]

To: jagusafr

“Watch: this State Department will recognize ISIS as a sovereign nation before this president leaves office.”

################

Probably fly their flag over the White House, too.


22 posted on 06/12/2014 1:16:08 PM PDT by Eccl 10:2 (Prov 3:5 --- "Trust in the Lord with all your heart and lean not on your own understanding")
[ Post Reply | Private Reply | To 19 | View Replies]

What one says is Never Comes the Day ... https://www.youtube.com/watch?v=8dzRdyC0abA ... What? Comes? Yes, it come a little bit less?


23 posted on 06/12/2014 1:18:58 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Eccl 10:2

inside it has # hash tags. That Wins Wars!


24 posted on 06/12/2014 1:20:54 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Mount Athos
Oh Mighty Isis!


25 posted on 06/12/2014 1:22:11 PM PDT by dfwgator
[ Post Reply | Private Reply | To 1 | View Replies]

Threshold ... in your world lame-stream ... You must hate your children and grand-children. What wall of Love do you have lame-stream media?
26 posted on 06/12/2014 1:24:13 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Mount Athos

The bearded savages are getting stronger. The threat is bigger. Our big guy doesn’t seen to mind. Wonder why.


27 posted on 06/12/2014 1:24:55 PM PDT by I want the USA back (Media: completely irresponsible. Complicit in the destruction of this country.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: dfwgator

yes, she wait there.


28 posted on 06/12/2014 1:25:24 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 25 | View Replies]

To: I want the USA back

It is the secrets of our soul.


29 posted on 06/12/2014 1:26:16 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 27 | View Replies]

Ever Heard the Voice? ... Tell Me Once More, Please ... This Sunlight is Calling You ... https://www.youtube.com/watch?v=-umqM9R8cnI


30 posted on 06/12/2014 1:30:42 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 29 | View Replies]

To: smokingfrog
I remember when Obama got pissed off when Malaki would not negotiate a withdrawal. So Obama had a temper-tantrum and left and took his football home with him. Now Malaki is begging for what was a foreseeable event. But Obama is _______-up (cowboyed-up) Obama is stiff-necked and wants to subjugate Malaki. The problem is there are about 15 million innocent Iraqis who just want to have a life.

If we don't help now, we will have to go back in and clean up a bigger mess. Sheeeeeeeeeesh!

31 posted on 06/12/2014 1:34:51 PM PDT by Texas Songwriter
[ Post Reply | Private Reply | To 4 | View Replies]

To: Texas Songwriter

Yes, Sir! Lay it on the Line! They come for U.S. if we do not! Why Let Them Lay?


32 posted on 06/12/2014 1:41:01 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Mount Athos

Islam has always been this way. It is in the DNA.


33 posted on 06/12/2014 1:47:21 PM PDT by Psalm 144 (Happier than a Svoboda skinhead with a free new armband.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: no-to-illegals

All of this is of Obama’s doing. He is Cloward-Piven-ing. He is overwhelming the system to bring about collapse. And out of those ashes, who knows what will rise. This man is the worst thing that has ever happened to this country. It cannot be said he ins ONLY incompetent (although this is certainly the fact), he wants to punish this country as he destroys it. He knows his time is short. He knows he must accelerate the destruction to reach his Marxist ends. And he is doing it right before our very eyes and the eyes of the Republican House of Representatives. But they care more about their power status than this country. I do not see any way to fix this mess.


34 posted on 06/12/2014 1:49:05 PM PDT by Texas Songwriter
[ Post Reply | Private Reply | To 32 | View Replies]

Yes, Never Comes the Day when the lame-stream reveals their love for their children or grand-children or your children or grand-children. They must be paid too well to lie. They (the lame-stream) does not care who dies ....


35 posted on 06/12/2014 1:50:00 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 32 | View Replies]

It comes down to Knights in White Satin. Hi, lame-stream, I know you hate America and are the Knights in White Satin. Racists!


36 posted on 06/12/2014 1:54:06 PM PDT by no-to-illegals (Scrutinize our government and Secure the Blessing of Freedom and Justice)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Mount Athos

No, I think Islam was the first terror group to build and Islamic state.


37 posted on 06/12/2014 1:56:11 PM PDT by matt1234
[ Post Reply | Private Reply | To 1 | View Replies]

To: Psalm 144

The Obama doctrine : airstrikes and drones
McCain/Grahm/GOPe doctrine: airstrikes,drones and troops

What great options. Maybe another trillion will fix it.
How about neither?

We don’t need to be involved in the Middle East.
Let them get the governance they deserve.


38 posted on 06/12/2014 3:39:26 PM PDT by TurboZamboni (Those who make peaceful revolution impossible will make violent revolution inevitable.-JFK)
[ Post Reply | Private Reply | To 33 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Surrenderkenyan ping.


39 posted on 06/12/2014 6:42:41 PM PDT by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: Mount Athos; 2ndDivisionVet; Cap Huff; SunkenCiv

If Abu Bakr al-Baghdadi is in control of the money ISIS stole from the bank, and can keep his influence on the fighters, he may have better bargaining power against those that have backed him so far: Saudi

http://www.foreignpolicy.com/articles/2014/06/12/iraq_mosul_isis_sunni_shiite_divide_iran_saudi_arabia_syria

What to do: Well, the usual thing follow the money!


40 posted on 06/12/2014 11:32:38 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson