Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russian Media on Downed Airliner: The CIA Did It
nbcnews.com ^ | July 21, 2014

Posted on 07/21/2014 1:16:53 PM PDT by Tailgunner Joe

Just one day after the horrific tragedy that left 298 people dead, Russia's Channel One ran a package telling its audience that the entire incident was orchestrated by the United States, specifically by the CIA. A document was broadcast purportedly showing that the U.S. was planning to do the same thing during the 1962 Cuban Missile Crisis.

Viewers learned that the "U.S. orchestrated this because Ukrainian government is not sophisticated enough to orchestrate this," according to the broadcast, which was translated from the original Russian by CNBC. According to Channel One, Russia's swift economic growth has inspired the United States to try to damage Russia's economy.

The government of Russian President Vladimir Putin financially supports and editorially controls a domestic media machine that has become reminiscent of the Soviet propaganda machine, and the former KGB agent has shut down most independent news channels that may stray from the Kremlin line.

(Excerpt) Read more at nbcnews.com ...


TOPICS: Foreign Affairs; Front Page News; Russia
KEYWORDS: amnesty; brennan; diversion; eu; imf; mh17; samanthapower; setuprussia; soros
Navigation: use the links below to view more comments.
first 1-5051-80 next last

1 posted on 07/21/2014 1:16:53 PM PDT by Tailgunner Joe
[ Post Reply | Private Reply | View Replies]

To: Tailgunner Joe

Isn’t it great that Hillary gave the Russians the Reset Button?


2 posted on 07/21/2014 1:18:48 PM PDT by Pearls Before Swine
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Riiiiight. And the moon landing was faked and I kidnapped the Lindbergh baby.


3 posted on 07/21/2014 1:18:55 PM PDT by RIghtwardHo
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe
A country run by a KGB colonel.

Could they be projecting?

4 posted on 07/21/2014 1:21:07 PM PDT by wideawake
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Probably the same CIA guys who invented crack cocaine in order to enslave American blacks and “keep ‘em down”.


5 posted on 07/21/2014 1:22:06 PM PDT by Sans-Culotte (Psalm 14:1 ~ The fool says in his heart, “There is no God.”)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Let’s seee.... the CIA sneaked a missile battery (capable of tracking and hitting an aircraft at 33,000 ft.) into a hostile battlefield, did the deed, and then sneaked out without anybody noticing.

Okay.


6 posted on 07/21/2014 1:22:46 PM PDT by alancarp
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

I’m not familiar with Channel One. Is it state-owned, or nominally state-owned?


7 posted on 07/21/2014 1:23:08 PM PDT by 1rudeboy
[ Post Reply | Private Reply | To 1 | View Replies]

To: alancarp

Jack Bauer could have done it.


8 posted on 07/21/2014 1:25:32 PM PDT by Blood of Tyrants (The cure has become worse than the disease. Support an end to the WOD now.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Tailgunner Joe

Actually, I saw a video last week that predicted something big after the BRICS summit. I think that we’ve learned over the past decade that the tinfoil hat brigade has been on to something for a long time.


9 posted on 07/21/2014 1:27:16 PM PDT by Bryanw92 (Sic semper tyranni)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

The CIA is not that smart, but, the One, able to garner a peace prize for nothing, would be diabolical enough to think he can out Putin Putin.


10 posted on 07/21/2014 1:30:45 PM PDT by depressed in 06 (America conceived in liberty, dies in slavery.)
[ Post Reply | Private Reply | To 1 | View Replies]

Propaganda unearthed by NBC news... The irony!


11 posted on 07/21/2014 1:33:46 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Well... These guys (The CIA) have been the gang who couldn’t shoot straight for years.

If they pulled this off, I would be shocked. And what is the upside for the CIA?

My money is still on a drunken Russian. Not sure what side he was nominally on.


12 posted on 07/21/2014 1:34:10 PM PDT by redgolum ("God is dead" -- Nietzsche. "Nietzsche is dead" -- God.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

It must be great when a compliant media acts as a propaganda outlet for a supreme dictator. Just ask Obama.


13 posted on 07/21/2014 1:34:48 PM PDT by Dalberg-Acton
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Well, John McCain got one thing right. He saw KGB when he looked into Putin’s eyes.

Broken clock ...


14 posted on 07/21/2014 1:38:58 PM PDT by BuckeyeTexan (There are those that break and bend. I'm the other kind. ~Steve Earle)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

What about the Jews? I’m surprised someone hasn’t blamed them by now.


15 posted on 07/21/2014 1:38:59 PM PDT by Opinionated Blowhard ("When the people find they can vote themselves money, that will herald the end of the republic.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

It appears the Russian public are more gullible and credulous than even Obama voters.


16 posted on 07/21/2014 1:43:30 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: alancarp

The Ukraine military uses the same BUK mobile missile system and has recently moved some BUK missile batteries into eastern Ukraine. How hard would it be for the CIA or one of its surrogates to gain access to one of these mobile systems?


17 posted on 07/21/2014 1:45:57 PM PDT by mac_truck ( Aide toi et dieu t aidera)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Tailgunner Joe

What’s sad is that many of the Russian people will believe it. In Russia, America is the tyrant of the Earth. What’s sad is that Obama and co are too lazy and/or incompetent to address this propaganda.


18 posted on 07/21/2014 1:47:12 PM PDT by Morpheus2009
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sans-Culotte

How the CIA Created the Crack Epidemic

Revolutionary Worker #873, September 15, 1996

In the early 1980s, a new drug, crack cocaine, appeared on the streets—at a time when many youth in the inner city were being forced into the underground economy in order to survive. New burdens were being added onto the poor. In a situation of intolerable poverty, unemployment, lousy health care, falling apart schools and crumbling housing, the spread of crack cocaine brought intensified conflicts between street organizations and the painful desperation of people addicted to the pipe. The government launched brutal new invasions by the police—a so-called “war on drugs”— using the spread of crack as an excuse.

This war on the people has resulted in an epidemic of police brutality and murder, the mass incarceration of Black and Latino youth, and the criminalization of a generation.It was widely believed that the sudden epidemic of crack cocaine into the oppressed communities—like the introduction of heroin in the Vietnam war era—could be traced to the authorities themselves.Now new facts are in, and it is revealed that this is precisely what has been going on.An exposé by reporter Gary Webb of the San Jose Mercury News reveals that agents working with the U.S. Central Intelligence Agency (CIA) sold tons of cocaine in the United States during those years and shipped the profits to the CIA-run army of Nicaraguan Contras. Webb based his work on “recently declassified reports, federal court testimony, undercover tapes, court records here and abroad and hundreds of hours of interviews over the past 12 months.” He was assisted by journalists Georg Hodel and Leonore Delgado.Webb’s report uncovered the names of the Contra operatives who bought tons of cocaine from the Colombian drug cartels and passed it on to various drug-dealing networks within the U.S. It documents how Contra drug dealers met with a major CIA agent before starting their operation. It reveals how the Salvadoran government air force flew the cocaine into Texas airfields. It details how tons of cheap cocaine flowed like a river into ghetto streets—first in Los Angeles and then beyond. And finally, Webb’s report documents the repeated U.S. government efforts to protect these operations.It has been a long struggle to break through the government coverup of this CIA cocaine traffic. During the congressional Iran-Contra hearings in the late 1980s, two people stood up in the audience and shouted “What about the cocaine!?” They were arrested and sentenced to over a year in prison.Long-time readers of our newspaper, the Revolutionary Workerwill remember many articles, especially in 1988 and 1989, exposing the CIA’s use of cocaine to finance their secret war in Central America. Our reports were based on the work of many other people—including the Christic Institute, columnist Alexander Cockburn, journalists Martha Honey and Tony Avirgan, filmmaker Barbara Trent (who created the film Coverup: Behind the Iran-Contra-Affair), and Professor Peter Dale Scott (author of The Iran Contra Connection—Secret Teams and Covert Operations in the Reagan Era).

Now an important new piece of the puzzle has fallen into place: Gary Webb documents that the CIA’s agents did more than participate in the cocaine trade. He reveals in detail the role they played in creating the crack explosion that has caused so much suffering among the people.Here is a U.S. government that publicly preached “Just Say No!” and sent an army of police to attack the people in the name of a “war on drugs.” And meanwhile, this same government had for years been at the nerve center of the operations that brought in the drugs!

Many people have suspected all along that the U.S. government was behind the crack explosion. Now here are the facts.In this article, we will pass on some of the information Gary Webb uncovered. And we will place it in the context of information documented by others about the role of the CIA and the Reagan/Bush White House in the cocaine trade.The full series by Gary Webb, called “Dark Alliance,” appeared in the San Jose Mercury News on August 18, 19 and 20. It is available on the Internet at http://www.sjmercury.com/drugs/.

The Nicaraguan Contras—
a Covert, Self-Financing
CIA Operation

http://revcom.us/a/firstvol/crack.htm


19 posted on 07/21/2014 1:48:43 PM PDT by ilovesarah2012
[ Post Reply | Private Reply | To 5 | View Replies]

To: Tailgunner Joe

People have to understand that Russian TV pretty much means government. The top 3 networks in Russia are (2) government owned outright and (1) owned by Gazprom which is government owned (actual majority)

Russian TV is pretty much the voice of the Kremlin


20 posted on 07/21/2014 1:49:48 PM PDT by GeronL (Vote for Conservatives not for Republicans)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 1rudeboy

75% owned by the government


21 posted on 07/21/2014 1:50:37 PM PDT by GeronL (Vote for Conservatives not for Republicans)
[ Post Reply | Private Reply | To 7 | View Replies]

To: mac_truck
Kiev has mercenaries fighting in eastern Ukranian. The pro-Kiev posters are quite open about that. It's quite possible those contract fighting have training on complicated weapons from previous contracts.

Should we worry? Yeah. The US caused ISIS, and they're out of control, well trained, smart, and capable of all kinds of mischief. I wouldn't be surprised if situations occur all over the world designed to instigate war.

22 posted on 07/21/2014 1:56:05 PM PDT by grania
[ Post Reply | Private Reply | To 17 | View Replies]

To: Tailgunner Joe

LOL

Maybe the writer of this fiction will earn a Politburo award..


23 posted on 07/21/2014 2:05:17 PM PDT by Vendome (Don't take life so seriously-you won't live through it anyway-Enjoy Yourself ala Louis Prima)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

Great, now the CIA e-mails will go missing. Oh wait, they
don’t have e-mail.

I think George Bush and Lindsey Lohan did it but
nobody will listen.

Or

Putin, you just shot down a civilian airliner and the
United States “Fagboy in Chief” is not happy, happy happy.

What you gonna do now?


24 posted on 07/21/2014 2:13:32 PM PDT by eyedigress ((zOld storm chaser from the west)/?s)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Morpheus2009

“In Russia, America is the tyrant of the Earth. What’s sad is that Obama and co are too lazy and/or incompetent to address this propaganda.”

Tough to do, when Obama and his people, in fact, the entire Democrat/Media complex, has been doing this for the last 20 years....


25 posted on 07/21/2014 2:17:39 PM PDT by tcrlaf (Q)
[ Post Reply | Private Reply | To 18 | View Replies]

To: Morpheus2009

26 posted on 07/21/2014 2:19:19 PM PDT by tcrlaf (Q)
[ Post Reply | Private Reply | To 18 | View Replies]

To: eyedigress

“I think George Bush and Lindsey Lohan did it but nobody will listen.”

Don’t laugh....
Just two hours ago, a Democrat wonk was live saying on CNN that the reason Hillary Clinton and Obama Foreign Policy is so weak, is because of.....

...wait for it....

Wait for it...

George Bush!!!!!


27 posted on 07/21/2014 2:22:05 PM PDT by tcrlaf (Q)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Tailgunner Joe; gandalftb; ASA Vet; nuconvert

Some technical background about the BUK-M system that was used against MH17:

http://corporalfrisk.wordpress.com/2014/07/19/the-buk-and-mh17/


28 posted on 07/21/2014 2:22:12 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: grania
Kiev has mercenaries fighting in eastern Ukranian. The pro-Kiev posters are quite open about that.

Show me.

29 posted on 07/21/2014 2:22:13 PM PDT by 1rudeboy
[ Post Reply | Private Reply | To 22 | View Replies]

To: grania
Should we worry?

You bet. I don't think Poroshenko even controls all the elements of his own government, especially the Interior Ministry.

30 posted on 07/21/2014 2:27:30 PM PDT by mac_truck ( Aide toi et dieu t aidera)
[ Post Reply | Private Reply | To 22 | View Replies]

To: tcrlaf

Of course I wouldn’t laugh.

The Common Sense crowd of the United States has spent all of their years trying to fix every mistake libtard nation throws at us.

They have a weak everything policy except when it comes to taxation on hard working Americans.

(You didn’t build That, Karl Marx DID!)


31 posted on 07/21/2014 2:33:59 PM PDT by eyedigress ((zOld storm chaser from the west)/?s)
[ Post Reply | Private Reply | To 27 | View Replies]

To: Morpheus2009

To be fair, Putin was popular during the Bush Administration as well. The Russian people have given up on trying to erect a truly free society and are embracing their serfdom past.


32 posted on 07/21/2014 2:42:05 PM PDT by Sam Gamgee (May God have mercy upon my enemies, because I won't. - Patton)
[ Post Reply | Private Reply | To 18 | View Replies]

To: 1rudeboy; grania
Kiev has mercenaries fighting in eastern Ukranian. The pro-Kiev posters are quite open about that.

I was curious too...did a search of 'ukraine mercenaries'.

Seems all of the stories are either Russian sources or western media repeating Russian claims of US mercenaries working for Greystone in Ukrainian uniforms trying to incite a civil war - they have been pushing this since April. Hardly pro-Kiev though.

It does explain where their absurd claim that the CIA shot down the jet came from. I must say in soviet accent...is boolsheet.

33 posted on 07/21/2014 2:47:55 PM PDT by eldoradude (How many republicrats/demoblicans does it take to change a light bulb?)
[ Post Reply | Private Reply | To 29 | View Replies]

To: eldoradude

I figured as much. Just don’t dare call it “propaganda.” Someone might mention MSNBC in order to change the subject.


34 posted on 07/21/2014 2:53:56 PM PDT by 1rudeboy
[ Post Reply | Private Reply | To 33 | View Replies]

To: mac_truck
How hard would it be for the CIA or one of its surrogates to gain access to one of these mobile systems?

Except Strelkov and his stooges already admitted to shooting it down, albeit they thought it was a Ukrainian transport carrier. Strelkov also admitted that the recordings from the Ukrainian SBU are real, he just claims he was "taken out of context" when talking to his Russkie handler.

Maybe Strelkov, a Russian GRU, is a double agent working for NATO?

35 posted on 07/21/2014 2:58:49 PM PDT by Greetings_Puny_Humans (I mostly come out at night... mostly.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: Greetings_Puny_Humans
Maybe Strelkov, a Russian GRU, is a double agent working for NATO?

...or maybe you're just regurgitating talking points from the Clinton/Kerry State Dept. with whom you share an agenda.

36 posted on 07/21/2014 3:35:47 PM PDT by mac_truck ( Aide toi et dieu t aidera)
[ Post Reply | Private Reply | To 35 | View Replies]

To: mac_truck
...or maybe you're just regurgitating talking points from the Clinton/Kerry State Dept. with whom you share an agenda.

Or more likely you are a tinfoil hat PaulBot just being a troll.

37 posted on 07/21/2014 3:39:10 PM PDT by Greetings_Puny_Humans (I mostly come out at night... mostly.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Tailgunner Joe

We’ll never know...


38 posted on 07/21/2014 3:39:37 PM PDT by Iscool
[ Post Reply | Private Reply | To 1 | View Replies]

To: RIghtwardHo

In light of the recent Malaysia Airlines tragedies (one missing, one brought down by the Russians) I completed a project I began some time ago to remind us of an earlier Russian involved murder of hundreds of innocents. Will someone please remind obozo that it’s still a jungle out there!
(It’s a short 8 minutes)
https://www.youtube.com/watch?v=HTgCIrUeuh0&list=UUFDlhK80EdO28R-iGTXiGaw


39 posted on 07/21/2014 3:41:39 PM PDT by Dick Bachert (Ignorance is NOT BLISS. It is the ROAD TO SERFDOM! We're on a ROAD TRIP!!)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Tailgunner Joe
Freedom of the press is highly overrated, especially if they are allied with enemies of the state.

By all rights we should have an anti-communist press in America, but in fact we have a pro communist press, just like in Russia.

They both serve the cause of international communism.

It's about time the Right in this country took matters in hand.

Create the conditions that make it impossible for the American marxists to ever seize power in the USA again.

40 posted on 07/21/2014 3:41:43 PM PDT by Rome2000
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sam Gamgee

As I recall, rubles terribly inflated an the awful hatred of Boris Yeltsin was brought Putin to power. After that, the Russian media is pretty much shilling for him along with our NSA defector Eddie being his cheerleader.


41 posted on 07/21/2014 3:41:43 PM PDT by Morpheus2009
[ Post Reply | Private Reply | To 32 | View Replies]

To: Tailgunner Joe

I’ve considered that angle.

I’ve considered the possibility that the Russian Separatists were justified in their rebellion, and they are now legitimately in control of that area, and for the defense of their military forces had to exert air superiority, then supremacy, then even domination, and shot down the airliner even out of mistaken identity, with perhaps the MH17 not pinging proper IFF.

The stolen credit cards, fraudulent use of them, bodily mishandling of the dead, and refusal to allow others into the 9 mile debris zone simply manifests lack of disciplined legitimate authority.

They are what they appear. Fraudulent, criminal rebellious thugs.


42 posted on 07/21/2014 3:49:04 PM PDT by Cvengr (Adversity in life and death is inevitable. Thru faith in Christ, stress is optional.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tailgunner Joe

They haven’t changed much since the ‘60s.


43 posted on 07/21/2014 4:20:51 PM PDT by familyop ("Dry land is not just our destination, it is our destiny!" --"Deacon," "Waterworld")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cvengr
They are what they appear. Fraudulent, criminal rebellious thugs.

There would be little to no civil strife in the Ukraine at this point if Putin wasn't busy arming the "separatists", providing them training, heavy weapons, etc. Those that say differently were probably the same people that claimed Russia didn't have its forces in Crimea. I remember Putinista's buying into that nonsense, or at least pretending they believed it. The lie became clear to all when Russia annexed it.

This is not some home grown insurgency, it is Russian backed and financed thugs who have zero legitimacy. I am pretty sure many of the so called leaders aren't even from the Ukraine at all.

This civilian plane was almost certainly brought down by mistake as this does not help the "separatists" or Putin. Either Putin/Russian trained "separatists" or Russian operators themselves made a careless, stupid mistake believing this was a Ukrainian transport. This weapon should never have been handed to "separatists" and Putin has blood on his hands for this one. No way around it.

44 posted on 07/21/2014 4:28:39 PM PDT by Longbow1969
[ Post Reply | Private Reply | To 42 | View Replies]

To: Cvengr

They are what they appear. Fraudulent, criminal rebellious thugs.


Somewhere between 50%-80% of the “rebels” are Russian nationals. All the top leaders are Russian nationals with documented FSB or GRU links. There is little authentically rebellious about Putin’s war in Ukraine. It is an astroturfed campaign made and managed in Moscow.


45 posted on 07/21/2014 4:31:38 PM PDT by lodi90
[ Post Reply | Private Reply | To 42 | View Replies]

To: Longbow1969

I am pretty sure many of the so called leaders aren’t even from the Ukraine at all.


Prime minister of Putinland Borodai and Strelkov/Girkin are from Moscow. One other leader who just “resigned” was Ukrainian. He sent his resignation letter from Russia. Probably in Siberia now. The new Putinland Deputy PM just appointed is an FSB guy wanted in Latvia for a coup attempt and murders in 1991.

As you can see, our local Putinists keep good company.


46 posted on 07/21/2014 4:41:15 PM PDT by lodi90
[ Post Reply | Private Reply | To 44 | View Replies]

To: mac_truck

#17:What are your sources re the Ukrainian govt is moving BUK units into eastern Ukraine? And why? The Soviet-created insurgents don’t have any fighters or bombers that I know of. Did they capture any in Donestk, etc?

The BUK units, either Soviet or captured Ukrainian ones (according to one unverified report), would be well guarded by the GRU-led “insurgents”. Strelkov is no amateur, unlike Obama.

A BUK complex, like that of the old SAM II/III systems, has a number of units - trucks/radar, missiles/chassis, etc. in order to function properly. These are not “shoot and scoot” MANPAD missiles.


47 posted on 07/21/2014 4:53:20 PM PDT by MadMax, the Grinning Reaper
[ Post Reply | Private Reply | To 17 | View Replies]

To: lodi90
As you can see, our local Putinists keep good company.

And they'll want to talk about anything but Putin's, completely irresponsibly, giving these heavy anti air weapons to a bunch of goons - that is if Russian operators themselves aren't responsible for this.

If you listen to the Putinista's here you'd believe the Ukraine is over run with Right Sector neo-con fascists secretly backed by some NATO/banker conspiracy. It's an odd combination they are pushing. Jewish fascists? Really? And never mind that Right Sector got a whopping 2% of the vote in the most recent election.

48 posted on 07/21/2014 4:53:57 PM PDT by Longbow1969
[ Post Reply | Private Reply | To 46 | View Replies]

To: Tailgunner Joe
The government of Russian President Vladimir Putin financially supports and editorially controls a domestic media machine ...

and a lot of keyboards on social media.

49 posted on 07/21/2014 4:56:02 PM PDT by Uncle Chip
[ Post Reply | Private Reply | To 1 | View Replies]

To: Greetings_Puny_Humans
No tinfoil is needed to catch you lying again. HERE is a clip from today's State Dept. press briefing to demonstrate how closely your rhetoric matches Marie Harf's.
50 posted on 07/21/2014 5:38:13 PM PDT by mac_truck ( Aide toi et dieu t aidera)
[ Post Reply | Private Reply | To 37 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-80 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson