Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Discovery of Bourbon Virus Raises Many Questions
Medscape ^ | Dec 24, 2014 | Robert Lowes

Posted on 12/26/2014 8:02:19 AM PST by AdmSmith

click here to read article


Navigation: use the links below to view more comments.
first 1-2021-4041 next last
The sequencing of DNA and RNA is very fast nowadays, so we will find many, many "new" viruses.
1 posted on 12/26/2014 8:02:19 AM PST by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; nuconvert
The Bourbon that you don't want:



http://viralzone.expasy.org/all_by_species/79.html
2 posted on 12/26/2014 8:05:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

You can thank Obama, Boner and McConman for importing it here.

Thanks, Open Borders Crowd, for exposing us to all the wonderful infectious diseases we didn’t have before.

As Jeb would say, “its an act of love.”


3 posted on 12/26/2014 8:06:31 AM PST by goldstategop (In Memory Of A Dearly Beloved Friend Who Lives In My Heart Forever)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

video: http://www.medicalnewsnetwork.org/NewsNetwork/DocTalk/B/Bourbon%20Virus


4 posted on 12/26/2014 8:07:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: goldstategop

No, that is not correct, you can thank the development of sequencing technology for all the “new” infectious dideases.


5 posted on 12/26/2014 8:09:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

I never had the bourbon virus, but there were a few times in my youth when I woke up with the Jack Daniels virus.


6 posted on 12/26/2014 8:10:56 AM PST by mkmensinger
[ Post Reply | Private Reply | To 1 | View Replies]

To: mkmensinger

I had the same and we are both lucky that it wasn’t the Bourbon ;-)


7 posted on 12/26/2014 8:12:27 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith

8 posted on 12/26/2014 8:12:35 AM PST by Brandonmark (There is still hope for our country! 11.04.2014 - DAY OF RENEWAL)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Ever notice that when a new virus is found in ticks or mice it is always in one area.

Then as if by magic it suddenly pops up in other regions far distant, as Hantavirus did in the 4 Corners region, then Washington state and other areas.

Same for Lyme disease.

Maybe these diseases have been here all along jut never found in humans till one got really sick.

There was also some tick born disease (Heartland) killed a man in Delaware County OK this year.


9 posted on 12/26/2014 8:14:15 AM PST by Ruy Dias de Bivar
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ruy Dias de Bivar

“Then as if by magic it suddenly pops up in other regions far distant...”

Well, ticks hitch rides on rodents and rodents hitch rides on anything that humans are riding in, so they can go anywhere pretty quick nowadays.


10 posted on 12/26/2014 8:19:10 AM PST by Boogieman
[ Post Reply | Private Reply | To 9 | View Replies]

To: Ruy Dias de Bivar

Yes, that is correct for the vast majority of cases, but there are some that are imported. Viruses are very interesting.

check these sites: http://www.virology.ws/ http://www.iayork.com/MysteryRays/ and https://flutrackers.com/forum/forum/the-pandemic-discussion-forum?f=36


11 posted on 12/26/2014 8:19:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

OMG! You mean I have to pour my Makers Mark down the drain?


12 posted on 12/26/2014 8:25:15 AM PST by Red_Devil 232 ((VietVet - USMC All Ready On The Right? All Ready On The Left? All Ready On The Firing Line!))
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ruy Dias de Bivar

all I know is that something better be done about ticks. just living with them is not going to work out. they don’t care if you are rural or not anymore. and they have so many damn diseases they are an evil cocktail of crap waiting to ruin the unfortunate person that happens to get unlucky.


13 posted on 12/26/2014 8:27:14 AM PST by roofgoat
[ Post Reply | Private Reply | To 9 | View Replies]

To: Boogieman

Do not forget Bambi and other http://en.wikipedia.org/wiki/Deer they should be hunted more. One deer can have 2000+ ticks.

The distribution of ticks http://www.cdc.gov/ticks/geographic_distribution.html


14 posted on 12/26/2014 8:29:58 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies]

To: AdmSmith

I thought it was a virus that in a certain bourbon.


15 posted on 12/26/2014 8:31:40 AM PST by wastedyears (I may be stupid, but at least I'm not Darwin Awards stupid.)
[ Post Reply | Private Reply | To 1 | View Replies]

Comment #16 Removed by Moderator

To: AdmSmith

Oh no. Does this mean that all those mint juleps at the Derby next year will have to contain a warning label?


17 posted on 12/26/2014 8:38:50 AM PST by mc5cents
[ Post Reply | Private Reply | To 1 | View Replies]

To: roofgoat

“all I know is that something better be done about ticks.”

Agree, here are some suggestions http://www.cdc.gov/Features/StopTicks/ and http://www.cdc.gov/ticks/avoid/in_the_yard.html

http://tickapp.tamu.edu/control.php

but the best preventive measurement is the old fashioned gun - Kill thousands of ticks with one shot - blast a deer!


18 posted on 12/26/2014 8:39:22 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: AdmSmith

LOL measurement => measure


19 posted on 12/26/2014 8:41:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18 | View Replies]

To: AdmSmith

The cdc cant even stop or acknowledge the over 300000 cases of tick borne lyme disease a year. they will also be clueless about atick borne virus.


20 posted on 12/26/2014 8:45:29 AM PST by freeangel ( (free speech is only good until someone else doesn't like it)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson