Replies

To: AdmSmith

Turkish: Cemal Kaşıkçı Arabic: جمال خاشقجي

23 posted on 10/08/2018 4:52:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

To: AdmSmith

If the Turks have the video, it is likely that the room that was used is known. It is difficult to get rid of all DNA.

24 posted on 10/08/2018 5:00:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794