Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Scientists Develop An 'Elixir' That Reverses A Known Cause Of Aging
i09.com ^ | 20 December 2013 | George Dvorsky

Posted on 12/22/2013 1:43:02 AM PST by Windflier

To date, we know of only two things that can reverse the effects of aging: caloric restriction and extensive exercise. But in a recent experiment, researchers applied a new compound to 2-year old mice, causing their muscles to regenerate to 6-month old levels. Incredibly, human trials may start next year.

The new compound, nicotinamide mono nucleotide (NMN), worked surprisingly quickly when tested on mice. When administered early enough in the aging process, it was found to work within one week; the muscles of older 2-year old mice were "indistinguishable" from the younger 6-month old animals. It improved muscle wastage, restored mitochondrial function and communication, and improved inflammation and insulin resistance, both of which are known causes of aging.

To put it into perspective, this result was like regenerating the muscles of a 60-year old human to those of a 20-year old.

Quite obviously, this comparison should be taken with a grain of salt; human aging and metabolism is quite different from that of mice. What's more, muscle strength did not improve (though the researchers are hoping to correct that). It's also an example of partial age reversal; the mice still have other age-related problems, like neurodegenerative decline and the shortening of telomeres.

But let's not get too down on the findings. What these Harvard Medical School researchers did is nothing short of amazing. Aging reversal. Moreover, the scientists are optimistic that the same compound will benefit healthy, young humans. To that end, the researchers are hoping to conduct human trials late next year.


TOPICS: Health/Medicine; Science
KEYWORDS: antiaging; longevity; mice; mouse

1 posted on 12/22/2013 1:43:02 AM PST by Windflier
[ Post Reply | Private Reply | View Replies]

To: Windflier

Puts me in mind of the STARGATE episode where RDA is afflicted with the rapid aging agent predominate on some planet. Of course, this is reversed in his case at the end, but not before he is interviewed by a native accustomed to a lifespan of a few weeks who asks him how long his race lives. He says, “eighty years”, and his correspondent says, “that’s forever,” and he says , “almost.”

Great episode.


2 posted on 12/22/2013 1:59:43 AM PST by dr_lew
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier

old soviet science.


3 posted on 12/22/2013 2:50:25 AM PST by cambyses
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier; shibumi

4 posted on 12/22/2013 3:35:44 AM PST by Salamander (Hey, Jack the Ripper, won't you come on over... hook me up to the power lines of your love...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier

I wonder if this will work with patients that have ALS?


5 posted on 12/22/2013 3:45:23 AM PST by Dacula
[ Post Reply | Private Reply | To 1 | View Replies]

To: Salamander

I’ll volunteer for the trial.

Now.


6 posted on 12/22/2013 3:56:25 AM PST by shibumi (Cover it with gas and set it on fire.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Windflier
The only problem with anti-aging though is you'll have subhuman pieces of pig filth like Nancy Pelosi living forever. We must not forget that there are great benefits to old age and death.
7 posted on 12/22/2013 4:24:00 AM PST by GrandJediMasterYoda (What do we want? Time travel. When do we want it? It's irrelevant.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier

Keep it away from Demonrats.


8 posted on 12/22/2013 4:25:14 AM PST by Carl Vehse
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier

Are they talking about nicotine?


9 posted on 12/22/2013 5:13:37 AM PST by meatloaf
[ Post Reply | Private Reply | To 1 | View Replies]

To: shibumi

“I’ll volunteer for the trial.

Now.”

I had this nightmare that they would find something that would stop aging. When I’m 78 years old. Hell, it’s too late for me NOW.


10 posted on 12/22/2013 5:54:07 AM PST by The Antiyuppie ("When small men cast long shadows, then it is very late in the day.")
[ Post Reply | Private Reply | To 6 | View Replies]

To: meatloaf

Watch how fast this is buried....cant have people living longer...pop. grows too fast as is....only very “special” important people will ever see this up close....


11 posted on 12/22/2013 5:59:26 AM PST by Therapsid (I am NOT the psychological warfare MASCOT.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: meatloaf

They are talking about a molecule that is widely used in biological systems often as an enzyme or co-factor - not tobacco, its most famous usage.


12 posted on 12/22/2013 6:01:02 AM PST by Aevery_Freeman (Remember who the real enemy is!)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Therapsid
Not exactly in the spirit of "ObamaCare and the Death Panels" is it.

Not a bad name for a band, though.

13 posted on 12/22/2013 6:02:56 AM PST by Aevery_Freeman (Remember who the real enemy is!)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Therapsid
only very “special” important people will ever see this up close

Reminds me of a story I once read in I think Omni mag when I was a kid. Rich guy buys new immortality drug. Everyone is excited although only the very rich can afford it. At the rich guy's press conference, someone broke through the crowd and shot him in the head.

14 posted on 12/22/2013 6:15:21 AM PST by meowmeow (In Loving Memory of Our Dear Viking Kitty (1987-2006))
[ Post Reply | Private Reply | To 11 | View Replies]

To: Windflier

Vitamin B3 AKA Niacin


15 posted on 12/22/2013 7:58:57 AM PST by PeaceBeWithYou (De Oppresso Liber! (50 million and counting in Afghanistan and Iraq))
[ Post Reply | Private Reply | To 1 | View Replies]

To: PeaceBeWithYou

Now we know why they’ve been putting out all the antivitamin talking points lately.


16 posted on 12/22/2013 8:00:58 AM PST by Black Agnes
[ Post Reply | Private Reply | To 15 | View Replies]

To: Windflier

There is mention of niacin, vitamin B3, which has long been known to improve muscle strength.


17 posted on 12/22/2013 8:07:27 AM PST by bgill
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...
...nicotinamide mono nucleotide (NMN)... improved muscle wastage, restored mitochondrial function and communication, and improved inflammation and insulin resistance, both of which are known causes of aging.
Thanks Windflier.
18 posted on 12/22/2013 8:08:39 AM PST by SunkenCiv (http://www.freerepublic.com/~mestamachine/)
[ Post Reply | Private Reply | View Replies]

To: Windflier

the question of such “rememdies” I believe will always be

whether or not just drinking a “cure” a couple times actually reverses an aging condition, after which continuing to drink it is unnecessary, or if the results of the “cure” can only be sustained by NOT ever quiting a regular regimen of drinking the “cure”

as usual, as always in the past, none of these cures have ever “reversed an aging process”; they have only offset the affect, some affect of an aging process - not the process itself, and only sustained any offset with continuation of the remedy without end


19 posted on 12/22/2013 10:14:33 AM PST by Wuli
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier

What could possibly go wrong here. Courtesy phone for Smilin’ Bob! Bob please pick up!


20 posted on 12/22/2013 11:13:23 AM PST by SgtHooper (If at first you don't succeed, skydiving is not for you.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Windflier; SunkenCiv

As with all interesting results this has been brewing for a long time

Nicotinamide mononucleotide protects against pro-inflammatory cytokine-mediated impairment of mouse islet function. http://www.ncbi.nlm.nih.gov/pubmed/21901281

Nicotinamide Mononucleotide, a Key NAD+ Intermediate, Treats the Pathophysiology of Diet- and Age-Induced Diabetes in Mice
http://www.cell.com/cell-metabolism/abstract/S1550-4131(11)00346-9

more here http://www.ncbi.nlm.nih.gov/pubmed/?term=Nicotinamide+mononucleotide


21 posted on 12/22/2013 12:29:58 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Thanks, Smith.


22 posted on 12/22/2013 2:47:54 PM PST by Windflier (To anger a conservative, tell him a lie. To anger a liberal, tell him the truth.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Windflier

Its useless unless it does away with facial wrinkles and sagging skin..and other stuff...:O)


23 posted on 12/22/2013 4:36:03 PM PST by goat granny
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson