Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Two men speak out against Obamacare, receive IRS notices on same day
Washington Times ^ | December 5, 2013 | Brenner Brief by Sara Marie Brenner

Posted on 12/07/2013 12:53:02 AM PST by Cincinatus' Wife

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-56 last
To: All

Is this an opportunity to publically burn those notices???

Kinda how the liberals burned bras and draft cards back in the day???

Where can I go to bad mouth Obamacare publically, and draw an IRS audit, I really wanna play too!!!


41 posted on 12/07/2013 11:29:38 AM PST by stevie_d_64 (It's not the color of one's skin that offends people...it's how thin it is.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wastoute

Excellent point!!!

Post of the day award!!!


42 posted on 12/07/2013 11:31:47 AM PST by stevie_d_64 (It's not the color of one's skin that offends people...it's how thin it is.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Cincinatus' Wife
This might be a coincidence, however:

Beginning with the Kennedy administration’s Ideological Organizations Project, which investigated, intimidated, and challenged the tax-exempt status of right-wing foundations, Mr. Andrew traces the ways Democrats and Republicans alike used the IRS to accomplish political goals during the 1960s and early 1970s. Seemingly innocuous names like Operation Leprechaun and Project Tradewinds, together with an array of intelligence and surveillance activities, formed a pattern of abuse that threatened the foundations of American political culture. In one of the most powerful and sobering passages of the book, Mr. Andrew chronicles the IRS’s Special Service Staff, which carried out activities that were more extensive and intrusive than Nixon’s infamous Enemies List—yet received scant coverage in the media.

review here:
http://muse.jhu.edu/login?auth=0&type=summary&url=/journals/journal_of_cold_war_studies/v007/7.3sbardellati.html

43 posted on 12/07/2013 11:47:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cincinatus' Wife

” Elliott twice voted for Obama”

“Here’s your sign”....


44 posted on 12/07/2013 12:37:23 PM PST by esoxmagnum (Turtles don't win fights, they just turtle up. Victory belongs to the aggressor, not the turtle.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Flick Lives

“It’s a terrorist tactic.”

It’s the Chicago Way


45 posted on 12/07/2013 12:43:59 PM PST by esoxmagnum (Turtles don't win fights, they just turtle up. Victory belongs to the aggressor, not the turtle.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Cincinatus' Wife

the same irS giving blindly 501c status to obama’s terrorist cousin non profit in Sudan according to Wallid Shoebat.


46 posted on 12/07/2013 1:55:10 PM PST by lavaroise
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; All
IRS using Google Maps to spy on taxpayers
47 posted on 12/07/2013 2:06:29 PM PST by Cincinatus' Wife
[ Post Reply | Private Reply | To 43 | View Replies]

To: Cincinatus' Wife
I steal a comment from your link:
With over 70,000 pages of tax code, their is no way anyone can possibly understand or be in full compliance of them.

With unlimited surveillance and access to data, those in power can target and find violations on anybody they want at any time for any reason.


A simplification of the tax code is overdue to say the least.
48 posted on 12/07/2013 2:20:13 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 47 | View Replies]

To: Cincinatus' Wife
Obama will most likely give blanket immunity to any criminal actions.
But then, in doing so it will be an admission of knowledge about the crimes.
But then, who really cares from the GOP enough to do anything.

It all makes me so angry.

49 posted on 12/07/2013 3:03:45 PM PST by MaxMax (Pay Attention and you'll be pissed off too! FIRE BOEHNER, NOW!)
[ Post Reply | Private Reply | To 7 | View Replies]

To: fieldmarshaldj; Perdogg; Impy; Clintonfatigued; AuH2ORepublican; NFHale; BillyBoy; GSP.FAN

I keep telling you Einsatzgruppen is THE ONLY answer, don’t I?

Am I wrong?


50 posted on 12/08/2013 9:03:54 AM PST by GOPsterinMA (You're a very weird person, Yossarian.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: fieldmarshaldj; GOPsterinMA; BillyBoy; AuH2ORepublican

Any tax collection agency would become the same thing would it not?

The problem goes far beyond a specific agency.


51 posted on 12/08/2013 3:14:55 PM PST by Impy (RED=COMMUNIST, NOT REPUBLICAN)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Impy; fieldmarshaldj; NFHale; BillyBoy; AuH2ORepublican

“The problem goes far beyond a specific agency.”

Yes. Maybe when the new “America” is formed, they can return to the roots of having a central government that provides national security and that’s about it.


52 posted on 12/08/2013 3:18:56 PM PST by GOPsterinMA (You're a very weird person, Yossarian.)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Impy

If allowed to run wild over time, yes. It’s why there needs to be strict parameters and oversight of every governmental agency. We also need tax simplification to the point that it can fit on a single page.


53 posted on 12/09/2013 4:09:14 AM PST by fieldmarshaldj (Resist We Much)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Foundahardheadedwoman

There are no coincidences.


54 posted on 12/09/2013 4:11:26 AM PST by zeebee (There are no coincidences.)
[ Post Reply | Private Reply | To 2 | View Replies]

The MSM, which will remain silent, is the Country’s greatest threat — the Goebbels of modern-day America.


55 posted on 12/09/2013 7:53:35 AM PST by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DH

Obama Socialized Health Insurance Tax is known as OSHIT.

RINO Socialized Health Insurance Tax will be known as RSHIT.

Would OSHIT or RSHIT be better?

The answer can be found in a quote from the most admired woman in America:

“What difference, at this late date, does it make?!”

_____________________

The Federal Fecal Finger, thanks to Rand Paul and a few other RINO Establishment Democrat wannabes, have come up with “RINO Socialized Health Insurance Tax.”

Thus, the Federal Fecal Finger has touched a perfectly good Health Insurance System and turned it first into OSHIT and then into RSHIT.

Our tax dollars at work!


56 posted on 12/10/2013 6:13:06 AM PST by Graewoulf (Democrats' Obamacare Socialist Health Insur. Tax violates U.S. Constitution AND Anti-Trust Law.)
[ Post Reply | Private Reply | To 17 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-56 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson