Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The Current Ebola Strain: It’s Airborne Folks
The Conservative Treehouse ^ | 8-5-14 | sundance

Posted on 08/05/2014 6:15:51 PM PDT by sheikdetailfeather

The empirical evidence of an airborne Ebola Strain is overwhelming

Hat Tip GWP - Patrick Sawyer was the American businessman, who contracted Ebola while working in Liberia, then collapsed after he got off a plane to Nigeria and died July 25. He was the first patient in Nigeria with the Ebola virus. The Nigerian authorities have refused to release the names of other passengers on the plane with Mr. Sawyer, or notify the media of their status.

(Excerpt) Read more at theconservativetreehouse.com ...


TOPICS: News/Current Events; Politics/Elections
KEYWORDS: airborne; airborneebola; barackobama; cdc; czar; democrats; doctor; ebola; ebolagate; ebolagraph; ebolainamerica; ebolaoutbreak; ebolaphonywar; ebolavaccine; ebolavirus; emory; epidemic; frieden; health; healthcare; hospital; jahrling; mutation; nigeria; nih; noitsnot; obama; obamasfault; obola; outbreak; pandemic; peterjahrling; protocols; publichealth; quarantine; quarantined; strain; talkradio; thomasfrieden; vaccine; who
Navigation: use the links below to view more comments.
first previous 1-20 ... 121-140141-160161-180 ... 301-302 next last
To: LurkingSince'98

Well, according to the data, it’s related to it. A close cousin, so to speak. There are a few others like Rabies were also mentioned.


141 posted on 08/05/2014 10:38:22 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 139 | View Replies]

To: informavoracious

Ebola is also on line with agenda 21 with a 90% kill rate. Matches perfectly. Now that they have a vaccine, they can use it.


142 posted on 08/05/2014 10:39:44 PM PDT by American in Israel (A wise man's heart directs him to the right, but the foolish mans heart directs him toward the left.)
[ Post Reply | Private Reply | To 29 | View Replies]

To: Cold Heat

By: Tia Ghose, LiveScience Staff Writer
Published: 03/21/2013 12:05 PM EDT on LiveScience

A single compound could stop several viruses, including rabies and Ebola, in their tracks, new research suggests.

The findings, published today (March 21) in the journal Cell Chemistry and Biology, could eventually lead to a broad-spectrum medicine for many viral diseases, similar to the way antibiotics work on bacterial infections.

“This new approach appears to work on multiple viruses rather than one,” said study co-author John Connor, a virologist at Boston University.


143 posted on 08/05/2014 10:42:16 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 141 | View Replies]

To: Cold Heat
Someone up the thread was concerned about the protection worn by doctors and nurses at Emory. Here is the latest advisory on PPE's.

"Infection Prevention and Control Recommendations for Hospitalized Patients with Known or Suspected Ebola Hemorrhagic Fever in U.S. Hospitals

Standard, contact, and droplet precautions are recommended for management of hospitalized patients with known or suspected Ebola hemorrhagic fever (Ebola HF), also referred to as Ebola Viral Disease (EVD) (See Table below). Note that this guidance outlines only those measures that are specific for Ebola HF; additional infection control measures might be warranted if an Ebola HF patient has other conditions or illnesses for which other measures are indicated (e.g., tuberculosis, multi-drug resistant organisms, etc.).

Though these recommendations focus on the hospital setting, the recommendations for personal protective equipment (PPE) and environmental infection control measures are applicable to any healthcare setting. In this guidance healthcare personnel (HCP) refers all persons, paid and unpaid, working in healthcare settings who have the potential for exposure to patients and/or to infectious materials, including body substances, contaminated medical supplies and equipment, contaminated environmental surfaces, or aerosols generated during certain medical procedures. HCP include, but are not limited to, physicians, nurses, nursing assistants, therapists, technicians, emergency medical service personnel, dental personnel, pharmacists, laboratory personnel, autopsy personnel, students and trainees, contractual personnel, home healthcare personnel, and persons not directly involved in patient care (e.g., clerical, dietary, house-keeping, laundry, security, maintenance, billing, chaplains, and volunteers) but potentially exposed to infectious agents that can be transmitted to and from HCP and patients. This guidance is not intended to apply to persons outside of healthcare settings.

As information becomes available, these recommendations will be re-evaluated and updated as needed. These recommendations are based upon available information (as of July 30, 2014)

144 posted on 08/05/2014 10:50:14 PM PDT by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 143 | View Replies]

To: Kartographer

Yes, good eventually triumphed but the road to that victory was spine chilling, at least for me.


145 posted on 08/05/2014 11:06:03 PM PDT by kalee
[ Post Reply | Private Reply | To 119 | View Replies]

To: Cold Heat; Pox; nuconvert
There is a lot of emotions in this thread, but it is understandable. However, I agree with you that at present Ebola is not airborne.

Henry Niman wrote this about the Novel Zaire Ebola Sub-Clade In Guinea and Sierra Leone:

The June Sierra Leone sequences have evidence of some drift from the March sequences from Guinea. A prior Zaire sub-clade, which was found in apes and a chimpanzee and was associated with an outbreak in Gabon in 2002 had strong evidence of recombination,( http://www.recombinomics.com/News/11150702/Ebola_Recombination.html ) which raises concerns of more evolution in the current sub-clade, which has produced a record number of reported Ebola cases and deaths.

http://www.recombinomics.com/News/07291401/Ebola_Zaire_Guinea_SL.html

Sooner or later we will have a deadly http://en.wikipedia.org/wiki/Pandemic , but it will most likely be an influenza, not based on Ebola.

146 posted on 08/06/2014 12:08:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 144 | View Replies]

To: taterjay

Yes, it is becoming clearer by the day and we seem powerless to stop it.


147 posted on 08/06/2014 12:22:16 AM PDT by informavoracious (Open your eyes, people!)
[ Post Reply | Private Reply | To 74 | View Replies]

To: CivilWarBrewing

That has to be the biggest stretch I’ve ever seen on FR.


148 posted on 08/06/2014 12:24:28 AM PDT by Kozak ("It may be dangerous to be America's enemy, but to be America's friend is fatal" Henry Kissinger)
[ Post Reply | Private Reply | To 4 | View Replies]

To: 2ndreconmarine; Fitzcarraldo; Covenantor; Mother Abigail; EBH; Dog Gone; ...
Ping...

Late, but a ping.

149 posted on 08/06/2014 2:11:06 AM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: informavoracious
George Bush was fully on board with Agenda 21, which requires the invasion of third worlders to destroy the American way of life.

As was Bill Clinton.

150 posted on 08/06/2014 2:13:02 AM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 29 | View Replies]

To: ClearCase_guy

Actually might help avoid some air borne infections...


151 posted on 08/06/2014 2:25:48 AM PDT by Kozak ("It may be dangerous to be America's enemy, but to be America's friend is fatal" Henry Kissinger)
[ Post Reply | Private Reply | To 8 | View Replies]

To: blackdog
A flea or mosquito bites an ebola patient. It then bites a previously uninfected human. Now we have a host issue.....

Insects and other creepy crawlies do not transmit Ebola. The virus does not survive in their bodies.

152 posted on 08/06/2014 3:12:03 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Williams

The monkeys most likely were infected by airborne droplets from the pigs. Droplet transmission is not like aerosol transmission, since droplets do not remain in the air and do not travel far.


153 posted on 08/06/2014 3:16:26 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 31 | View Replies]

To: LurkingSince'98
The nurse who is now coming back with EBOLA never saw and infected patient she just spray cleaned their contaminated suits

I refer to her as an assistant, because she was helping with decon and is not a healthcare provider as far as I know.

Apparently, one of the other people working in the decontamination area became ill and continued to show up for work while sick. Subsequently, that person died of Ebola. So Ms. Writebol was infected directly as a result of breech of infection control protocol.

154 posted on 08/06/2014 3:21:36 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 41 | View Replies]

To: ansel12
It looks we have had Ebola virus in the U.S. for years and have been infecting monkeys for testing, so bringing in that American doctor hardly introduced it here.

Quite true. Every strain of Ebola known is present in US labs.

155 posted on 08/06/2014 3:23:43 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 50 | View Replies]

To: GGpaX4DumpedTea

Right... because inducing kidney failure with massive doses of an acid in patients who are already at great risk of organ failure sounds like a great therapeutic strategy.


156 posted on 08/06/2014 3:25:51 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 53 | View Replies]

To: LurkingSince'98
Prove to me that this strain is airborne!

This strain is only airborne in the sense that three people who were verified to have the disease flew on airplanes.

As it turns out, all three are/were Americans. There is fodder for wild conspiracy theorizing right there.

157 posted on 08/06/2014 3:38:05 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 88 | View Replies]

To: Cold Heat
The Animal strain, a one time event in the US in Reston Va, did, but the virus disappeared and only exists in test tubes right now. But it was absolutely harmless to the human immune system. Even contracted from infected blood via a cut in the skin, the virus disappeared in the human.

FYI... the Reston strain has appeared twice in the US, once in (obviously) Reston, VA, and the second time in TX. It has been found in pigs in China and the Philippines, and appears to be endemic in both countries. I do not know if the reservoir has been identified.

As of a few years ago, a total of 15 people had been shown to have seroconverted. Active viremia was established in at least one case, but no symptomatic disease has ever been observed. Given the pathogenicity of the other known Ebola strains, the Reston strain is treated as a BSL4 agent and considered to have the same VHF potential (until proven otherwise... which may be a while).

I'm quoting from memory, but this information was all published in the WHO experts consultation on Ebola Reston pathogenicity in humans (1999).

158 posted on 08/06/2014 3:47:46 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 96 | View Replies]

To: sheikdetailfeather

http://www.freerepublic.com/focus/f-news/3189512/posts

“Ebola is not an easily transmissible virus. It requires direct contact with bodily fluids. It doesn’t travel on the respiratory route.”


159 posted on 08/06/2014 3:53:11 AM PDT by Drango (A liberal's compassion is limited only by the size of someone else's wallet.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LurkingSince'98
I asked the question: Why Oh Why are they suited up with respirators if there is no airborne hazard????

I would think that if you were treating patients who could vomit, bleed, or splash diarrhea on you at any time, you also would want to be wearing an impermeable suit. The virus does not have to be airborne to splash into your eyes, nose, or mouth.

160 posted on 08/06/2014 3:53:25 AM PDT by exDemMom (Current visual of the hole the US continues to dig itself into: http://www.usdebtclock.org/)
[ Post Reply | Private Reply | To 103 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 121-140141-160161-180 ... 301-302 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson