Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

400 dead Russians and Syrians, yet no one knows who ordered them to attack US forces in Syria
Middle East Monitor ^ | Feb 24, 2018 | staff

Posted on 02/24/2018 7:18:39 AM PST by Eddie01

The United States is still unsure who directed a February 7 attack on US and US-backed forces in Syria, Defense Secretary Jim Mattis said on Saturday, even as he acknowledged accounts that Russian civilian contractors were involved.

Reuters has reported that about 300 men working for a Kremlin-linked Russian private military firm were either killed or injured in Syria.

The US has estimated about 100 pro-Syrian government forces were killed by US strikes to repel the Febuary 7 attack.

Russian military officers told the United States during the incident that Moscow was not involved. The Pentagon has declined to comment on the exact makeup of the attacking forces and Mattis appeared at a loss to explain the incident 10 days later.

“I still cannot give you any more information on why they would do this. But they took direction from someone,” Mattis told reporters flying back to Washington with him from a trip to Europe, according to a Pentagon transcript.

“Was it local direction? Was it from external sources? Don’t ask me. I don’t know.”

Mattis said he “understood” that Moscow had acknowledged contractors were involved, without elaborating on whether that understanding came from press reports. Russian officials have told reporters that five Russian citizens may have been killed in clashes with US-led coalition forces.

Still, Russian officials deny they deploy private military contractors in Syria, saying Moscow’s only military presence is a campaign of air strikes, a naval base, military instructors training Syrian forces, and limited numbers of special forces troops.

But according to people familiar with the deployment, Russia is using large numbers of the contractors in Syria because that allows Moscow to put more boots on the ground without risking regular soldiers whose deaths have to be accounted for.

The contractors, mostly ex-military, carry out missions assigned to them by the Russian military, the people familiar with the deployment said. Most are Russian citizens, though some have Ukrainian and Serbian passports.

The United States and Russia, while backing opposite sides in the Syria conflict, have taken pains to make sure that their forces do not accidentally collide. But the presence of the Russian contractors adds an element of unpredictability.

The US military has said that in its effort to repel the attack on February 7, US forces on the ground called in coalition strikes for more than three hours, involving F-15E fighter jets, MQ-9 drones, B-52 bombers, AC-130 gunships and AH-64 Apache helicopters.

The US military has said the attacking forces were aligned with the Syrian government and were backed by artillery, tanks, multiple-launch rocket systems and mortars.

“I doubt that 257 people all just decided on their individual own selves to suddenly cross the river into enemy territory and start shelling a location and maneuvering tanks against it,” Mattis said.

“So whatever happened, we’ll try to figure it out. We’ll work with, obviously, anyone who can answer that question, but I cannot, at this time.”


TOPICS: Foreign Affairs; News/Current Events; Russia; Syria; War on Terror
KEYWORDS: attack; chechnya; dead; erdogan; hassannasrallah; hezbollah; iran; kurdistan; lebanon; plausibledeniability; putinsbuttboys; putinworshippers; receptayyiperdogan; russia; russianaggression; serbia; syria; turkey; waronterror
Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 next last
Uranium One FBI Informant Is Revealed: Will Testify, Provide Evidence

21 posted on 02/24/2018 8:27:25 AM PST by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | View Replies]

Iran's President Hassan Rouhani, Russia's Vladimir Putin and Turkey's Tayyip Erdogan meet in Sochi, Russia November 22, 2017. (photo credit: SPUTNIK/MIKHAIL METZEL/KREMLIN VIA REUTERS)

Column One: Portents of quagmires in Syria

22 posted on 02/24/2018 8:27:31 AM PST by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | View Replies]

To: Eddie01; AdmSmith; AnonymousConservative; Berosus; Bockscar; BTerclinger; cardinal4; ColdOne; ...
Thanks Eddie01. It was, no doubt, a consensus between the big two (Putin and the Shiite-head), the half-pint (Erdogan, ironically much taller than the other two), and the kick-dog (Assad), and was an attempt to humiliate the US and create domestic difficulties for President Trump. Nice try, f-heads.

23 posted on 02/24/2018 8:29:48 AM PST by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | View Replies]

To: Eddie01

Syria is no longer a country. The proxy civil war there has destroyed it, and sent millions of people to Europe. Everyone with any interest has taken a piece of the country.

Everyone really needs to question the motives of Obama and Hillary when they launched this war.


24 posted on 02/24/2018 8:54:26 AM PST by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: PGR88

“” “” Everyone really needs to question the motives of Obama and Hillary when they launched this war.”” “”

You are kidding, right? It is clear as day.


25 posted on 02/24/2018 8:58:31 AM PST by NorseViking
[ Post Reply | Private Reply | To 24 | View Replies]

To: Eddie01

Only three logical probabilities - a Russian probe of U.S. defenses, a Russian intelligence error, or a rogue commander of the Russian “contractors”.

I don’t think the U.S. military is as unsure of just who is to blame as they pretend they are. It is better that they never tell the Russians they know as much as they do know, and telling anyone in the media is telling the Russians by default.


26 posted on 02/24/2018 9:21:49 AM PST by Wuli
[ Post Reply | Private Reply | To 1 | View Replies]

To: WilliamIII

Because the President is free to act in Syria, but has to get money and authorizations from the communists and cheap-labor-express capitalists in Congress to get a wall.


27 posted on 02/24/2018 9:40:55 AM PST by pierrem15 ("Massacrez-les, car le seigneur connait les siens")
[ Post Reply | Private Reply | To 8 | View Replies]

To: txhurl

Correct me if I am wrong, but I don’t think Blackwater has ever had anything much above small arms. This Wagner has tanks, howitzers and MRLSs.


28 posted on 02/24/2018 9:43:31 AM PST by Krosan
[ Post Reply | Private Reply | To 18 | View Replies]

To: Extremely Extreme Extremist

GET THE HELL OUT.


^This + 1


29 posted on 02/24/2018 9:44:03 AM PST by VTenigma (The Democrat party is the party of the mathematically challenged)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Eddie01

Just read it, GREAT!

How many aircraft ran into each other due to incompetence and lack of training?

Must be it’s just our Navy that sucks! /SARC!!!


30 posted on 02/24/2018 9:48:47 AM PST by faucetman (Ju"st the facts, ma'am, Just the facts)
[ Post Reply | Private Reply | To 13 | View Replies]

To: Krosan; Publius; Squantos; combat_boots; colorado tanker

Correct me if I am wrong, but I don’t think Blackwater has ever had anything much above small arms. This Wagner has tanks, howitzers and MRLSs.


I could not be the one to correct you, but I have friends who can ;)


31 posted on 02/24/2018 9:52:22 AM PST by txhurl (The Final Thunderdome: Two Americas enter, One America leaves.)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Travis McGee

Missed one!


32 posted on 02/24/2018 9:53:28 AM PST by txhurl (The Final Thunderdome: Two Americas enter, One America leaves.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: Krosan

With so many groups running over each other back and fourth heavy weapons are dime per dozen there.
I think a tank cost like 90 goats, a pickup truck and a camel. That being Abrams of course. T-55 is half that much.


33 posted on 02/24/2018 9:56:58 AM PST by NorseViking
[ Post Reply | Private Reply | To 28 | View Replies]

To: Eddie01

More info + video https://www.freerepublic.com/focus/news/3632066/posts?page=81#81


34 posted on 02/24/2018 9:59:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eddie01

The contactors were paid by Assad to make this attack.

The Russian military built the temporary bridge as their part of the assault.

Assad and Iran were the main drivers as Syria is now effectively partitioned with the new Kurdish country of Rojava and other Kurd controlled lands essentially all of Syria east of the Euphrates to the Iraq border.

The assault force did not believe that the Kurds would be reinforced by US air power. The assault force attacked without artillery or air power. Incredible mistake.


35 posted on 02/24/2018 10:04:46 AM PST by gandalftb
[ Post Reply | Private Reply | To 1 | View Replies]

To: Bishop_Malachi
When did Congress authorize a troop presence in Syria?

The United States doesn't have any national security interests in Syria, especially not against the legitimate government of Syria.

First it was catch and release of ISIS fighters in Raqqa, now they're attacking Syrian government forces and Russian combat engineers directly.

No wonder the ceasefire negotiations in East Ghouta are being side tracked and the Russians have brought in stealth aircraft.

36 posted on 02/24/2018 10:08:51 AM PST by mac_truck (aide toi et dieu t'aidera)
[ Post Reply | Private Reply | To 7 | View Replies]

To: gandalftb

“So whatever happened, we’ll try to figure it out. We’ll work with, obviously, anyone who can answer that question, but I cannot, at this time.”
=
‘Mount an offense out of recognizable uniform, this could happen to you, too.’


37 posted on 02/24/2018 10:18:25 AM PST by txhurl (The Final Thunderdome: Two Americas enter, One America leaves.)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Eddie01

Bah: everyone knows exactly what happened and why.

Deir Zour is an oil field held by pro-Kurd forces and a bargaining chip for their future relation with the Syrian government.
After the failed attack the Syrians reinforced the Kurds in Afrin.
Only a fool wouldn’t know what happened.


38 posted on 02/24/2018 10:23:14 AM PST by mrsmith (Dumb sluts: Lifeblood of the Media, Backbone of the Democrat/RINO Party!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eddie01

Bush almost expanded the war in Syria, that’s historic record. Assad was friends with the Jihadists when they went after Coalition forces, they harbored Saddam’s brother. Iraq’s PM accused Syria and Assad of working with Al Qaeda, he was even found guilty of it in trial in the US. Everyone knows, a lot of Saddam’s old cronies went on to form ISIS. Same ol’ same ol’ we hear.


39 posted on 02/24/2018 10:31:35 AM PST by BeadCounter
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eddie01

Wonder if there is any video of that attack and response posted publicly?

That’s a very high count of KIAs


40 posted on 02/24/2018 10:33:16 AM PST by wildbill (Quis Custodiet ipsos custodes? Who watches the watchmen?)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson