Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

USAF investigates mystery company that's bought 55,000 acres around major California air force base costing $800 MILLION - amid security fears it may be connected to a hostile power
Daily Mail ^ | 7/08/23 | Neirin Gray Desai

Posted on 07/08/2023 2:10:00 AM PDT by Libloather

Government officials are investigating a mysterious company that has bought around 55,000 acres of dry farmland around a USAF base in California.

Travis Air Force base, northeast of San Francisco, houses large transport aircraft used for refueling smaller planes and sending aid and munitions around the world.

Starting in 2018, a company called Flannery Associates LLC has spent around $800million buying swathes of land around the base, leaving local, state and federal officials flummoxed as to who they are and what they want with it.

An attorney representing Flannery told The Wall Street Journal the company is controlled by US citizens and that 97 percent of its capital comes from American investors - with the remaining investments coming from British and Irish citizens.

In a letter to Solano County, the majority of which is owned by Flannery, the company is described itself as being 'owned by a group of families looking to diversify their portfolio from equities into real assets, including agricultural land in the western United States,' according to county newspaper the Daily Republic.

But after eight months of investigation, the Air Force's 'Foreign Investment Risk Review Office' has failed to identify any one individual behind the Flannery, according to the Journal.

Meanwhile, the US Agriculture Department has made its own inquiries, also to no avail.

'Nobody can figure out who they are,' Ronald Kott, mayor of nearby Rio Vista, which is now largely surrounded by Flannery land, told The Journal. 'Whatever they're doing - this looks like a very long-term play.'

Over the years that Flannery, registered in Delaware, has been buying up land, it has given a variety of accounts and indications as to what it wants to do with it.

An attorney for Flannery, Richard Melnyk, said in an email to the county in 2019...

(Excerpt) Read more at dailymail.co.uk ...


TOPICS: Business/Economy; China; Front Page News
KEYWORDS: 2018; baseplots; blackrock; california; ccp; china; delaware; flannery; flanneryassociates; gavinnewsom; globalwarming; landgrabs; melnyk; milbaseplots; militarybases; mystery; nancypelosi; realestate; richardmelnyk; riovista; sanfrancisco; security; solanocounty; travisafb; usaf; windfarms
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-77 next last
To: Libloather

With all the Chinese coming across the border the Chinese Communist Party plans to build it’s own base


41 posted on 07/08/2023 7:32:37 AM PDT by butlerweave
[ Post Reply | Private Reply | To 1 | View Replies]

To: RoosterRedux

Dictionary Definitions from Oxford Languages Learn more

flum·moxed

adjective

bewildered or perplexed.
“he became flummoxed and speechless”

This was a favorite word used by my grandparents, parents, uncles and aunts.


42 posted on 07/08/2023 7:33:39 AM PDT by Grampa Dave (We have no shortage of experts, stating B$ as fact, & they have no idea nor reality re solutions!!)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Libloather

An interesting article about the Flannery Group.

https://www.dailyrepublic.com/all-dr-news/solano-news/solano-county/flannery-sues-solano-county-landowners-for-510-million/comment-page-1/


43 posted on 07/08/2023 7:38:59 AM PDT by Grampa Dave (We have no shortage of experts, stating B$ as fact, & they have no idea nor reality re solutions!!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SaveFerris

“Probably Donna Chang.

Or a group made up of real Chinese, funded by the Chinese government.”

Didn’t think the Chinese could pronounce Flannery.

🤣🤣


44 posted on 07/08/2023 7:42:18 AM PDT by 2CAVTrooper (Freedom is the sure possession of those alone who have the courage to defend it.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Libloather
It's a mystery.

Based on the lawyers background, there's a good chance Flannery LLC is a cover for some DC establishment types who have inside information on the future of Travis AB.

This is in Nancy Peolsi's backyard.

45 posted on 07/08/2023 7:44:27 AM PDT by mac_truck (aide toi et dieu t'aidera)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Grampa Dave
I've always been rather fond of the word "flummoxed"... hence my original comment.

It has a nice sound and feel to it.

46 posted on 07/08/2023 7:44:49 AM PDT by RoosterRedux (See my FR homepage for a link to the entire Bible narrated by David Suchet on youtube. FREE!)
[ Post Reply | Private Reply | To 42 | View Replies]

To: AndyJackson

“You do know that each of the services has its own security, intel, and investigative organizations?”

It’s highly unlikely that such things as intel and security exist at government agencies. If you’re looking for qualities that exist at these agencies, try fat, stupid, drunk and horny.


47 posted on 07/08/2023 7:49:54 AM PDT by sergeantdave (AI is the next iteration of a copy and paste machine.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: AndyJackson

You do know that each of the services has its own security, intel, and investigative organizations?
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Yes, I was just making a point concerning the apparent ineptitude of the FBI/CIA.


48 posted on 07/08/2023 7:51:06 AM PDT by fortes fortuna juvat (Current POPE and POTUS: corrupt, ignorant, paranoid, angry, deeply hateful, and deeply despised.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: Libloather; AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; ..

That describes the California Democratic Party.


49 posted on 07/08/2023 7:53:31 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Libloather

B.S.

The U.S. Government can’t figure out who owns 55,000 acres? Surrounding an Air Force Base?

B.S.


50 posted on 07/08/2023 8:05:20 AM PDT by saleman
[ Post Reply | Private Reply | To 1 | View Replies]

To: Libloather

As long as Bidet* got his 10%.....


51 posted on 07/08/2023 8:06:01 AM PDT by doorgunner69 (Let's go Brandon)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Libloather

Sounds Irish.


52 posted on 07/08/2023 8:27:21 AM PDT by ansel12 (NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Libloather

Try this https://opencorporates.com/companies/us_de/6731909


53 posted on 07/08/2023 8:30:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: uptowngirl

Didn’t they say that about Japan back in the 80’s.

Then it comes out the Iraq owned some major holdings during desert storm II.


54 posted on 07/08/2023 8:36:09 AM PDT by Leep (What skill or service did the biden family have that netted them tens of millions of dollars?)
[ Post Reply | Private Reply | To 35 | View Replies]

To: butlerweave

Also, didn’t al-Qaeda supposedly have terrorist training camp set up in the U.S.?


55 posted on 07/08/2023 8:38:20 AM PDT by Leep (What skill or service did the biden family have that netted them tens of millions of dollars?)
[ Post Reply | Private Reply | To 41 | View Replies]

To: RoosterRedux

overly dramatic. Means bewildered and perplexed. I don’t agree with applying emotional adjectives for countries and organizations.

The officials didn’t find an answer yet, I seriously doubt they are experiencing bewilderment.


56 posted on 07/08/2023 12:27:38 PM PDT by Williams (Stop Tolerating The Intolerant)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Libloather

The Air Farce is investigating??? Isn’t that the job of the DOJ?… Wait.. Sorry. We have no DOJ any longer.


57 posted on 07/08/2023 1:03:05 PM PDT by MGunny ( )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Williams
That's what makes the love of words and writing so much fun.

The word "flummoxed" doesn't have the same visceral meaning for me but I can understand where you are coming from.

58 posted on 07/08/2023 1:06:46 PM PDT by RoosterRedux (See my FR homepage for a link to the entire Bible narrated by David Suchet on youtube. FREE!)
[ Post Reply | Private Reply | To 56 | View Replies]

To: Leep; Clovis_Skeptic

Also, didn’t al-Qaeda supposedly have terrorist training camp set up in the U.S.?

Why is there an Islamic Village in the foothills near Fresno?
KFSN TV 30 Fresno, CA ^ | 11-07-01 | Kevin Quinn
Posted on 11/08/2001 8:14:41 AM PST by Clovis_Skeptic

.Why is there an Islamic Village in the foothills near Fresno? There’s an airstrip and neighbors complain of gunfire. Kevin Quinn takes you inside Baladullah, California.
Sorry, no transcript as of now. Video only. Worth the effort to view.

The video provides a look at this compound in the foothills above Fresno, CA. Pre 9-11, a Fresn County Sheriffs deputy was killed by a member of this peaceful Islamic community. The suspect (in the beginning trial phase still) broke into a empty nearby foothill home, when deputies arrived this guy was lying in the hallway floor with a rifle, and killed one deputy. This video is the first investigative reporting we have had on this Islamic community. The trail leads to FUQRA, a known terrorist group operating all over the world, and have several communities such as this one all over the USA.

Here is an excerpt from an article of the Sacramento Bee...

California links of terrorists probed:
Federal and state investigators try to unearth ‘sleeper’ agents.
By Sam Stanton and Andy Furillo
Bee Staff Writers
(Published Sept. 30, 2001)

The compound Beyond seeking out ties to bin Laden-linked terrorist networks, officials are keeping tabs on another Islamic group near Fresno because of the recent killing of a sheriff’s deputy in an area home, apparently stemming from a botched burglary.(this was no burglary according to all accounts)

There is no evidence that the Fresno group has been involved in any terrorist activities, officials say.

The group, according to a federal source, is part of Fuqra, an organization whose name means “poverty” in Arabic and which has had compounds in several U.S. areas.

Some Fuqra members in other areas have been implicated in past years in domestic terrorist attacks, and the State Department has labeled the group, known formally as Jamaat ul-Fuqra, as “an Islamic sect that seeks to purify Islam through violence.”

The group south of Fresno operates an 1,800-acre compound called the International Quranic Open University, which sits on the former site of the drug addiction recovery cult Synanon.

The compound, a series of mobile homes shaded by trees, also serves as a U-Haul rentals location. A resident there last week refused to talk to a reporter, referring inquiries to a Visalia attorney who did not respond to a message seeking information.

Authorities have been studying the compound since the Aug. 21 slaying of Fresno County Sheriff’s Deputy Erik Telen. Officials charged 20-year-old Ramadan Abdur-Rauf Abdullah with murder in the killing, apparently stemming from a botched burglary at a rural home.

James Oppliger, Fresno County’s chief deputy district attorney, said the suspect claimed he had been living at the compound seeking psychiatric treatment from the Quranic university.

Oppliger said he since has begun studying the group and its possible connections to other organizations.

(Zavia Books) is the bookstore for this Islamic compound. It is called Koranic Open University. Note the books being sold. One of them is prefaced by ( Sheik Mubarik Ali Shah Jilani [Gilani]) a known terrorist. The trail leads from Baladullah (actually Miramonte, CA) to Pakistan, where Sheik Gilani lives. He is the head of Fuqra.

https://freerepublic.com/tag/by:clovisskeptic/index?more=53327710

The religious community known as Baladullah.
It was one of several rural enclaves established around the country by mostly African-American followers of a Pakistani cleric known as Sheik Mubarik Ali Gilani.”

Gateway Academy Superintendent Khadijah Ghafur

Yes, he shot and killed Fresno County Deputy Sheriff Erik Telen.


59 posted on 07/08/2023 1:33:27 PM PDT by Grampa Dave (We have no shortage of experts, stating B$ as fact, & they have no idea nor reality re solutions!!)
[ Post Reply | Private Reply | To 55 | View Replies]

To: Grampa Dave

Thanks for digging that up.


60 posted on 07/08/2023 2:00:54 PM PDT by Leep (What skill or service did the biden family have that netted them tens of millions of dollars?)
[ Post Reply | Private Reply | To 59 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-77 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson