Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

The Modern Hebrew Alphabet is Actually Aramaic
Hebrew Roots Project ^ | March 2011 | Reuven

Posted on 04/09/2011 7:16:28 AM PDT by Pharmboy


An example of ancient Hebrew script...a derivation of proto-Canaanite

During the years I've been researching [My name is Reuven; An English teacher by profession, I...possess an insatiable desire to research anything pertaining to my Jewish roots. Born [and] raised in New York City, I have been an Israeli citizen for more than 30 years, and reside in the charming Galilian town of Karmiel] the Hebrew language and alphabet, I've been astounded to discover that the overwhelming majority of Jews and Christians - even observant ones - have been unaware of the existance of the original ancient Hebrew alphabet, the script in which the Ten Commandments were engraved and the first Torah scrolls were written.

It was the script which served the Israelites from the time of the Forefathers up till the Babylonian Exile. It is my intention, then, by means of this site, to convey basic information about this vital aspect of the Judeo-Christian heritage.

When and why did the Aramaic/Assyrian script replace the Ancient Hebrew script?

Towards the end of the First Temple Period, the Aramaic language had become the lingua franca of what today is the Mideast. Israelites were still using the ancient alphabet, but beginning to speak Aramaic. The minority of Jews who were exiled during the Babylonian Captivity must have found writing in the Aramaic script expedient for managing their daily lives, so by the time they were granted permission to return to their homeland and rebuild the Temple, they were thoroughly immersed in that script, and even may have forgotten their original alphabet. The majority of Israelites, who were never exiled but were ruled by a puppet government, undoubtedly retained their original script, although by then they were all speaking Aramaic and transliterating their spoken Hebrew into Aramaic letters.

(Excerpt) Read more at hebrew-roots-project.com ...


TOPICS: History; Religion
KEYWORDS: aramaic; aramaicalphabet; epigraphyandlanguage; faithandphilosophy; godsgravesglyphs; hebrewalphabet; letshavejerusalem; oldtestament; protohebrew; torah
Navigation: use the links below to view more comments.
first 1-5051-64 next last
Full disclosure: I grew up with Reuven in NYC, and we had lost touch but re-engaged by way of the Internet. In Skype conversations, I learned much from him and suggested he share his knowledge and build a web site.

Reuven makes no money from this site...there are no ads. He simply has an (amateur) scholar's drive to get at the truth.

I am posting this because I doubt if more than just a few Freepers know that contemporary Hebrew (actually, for the last two thousand years, more or less) is actually written in the Aramaic alphabet.

I posted this as an excerpt since I did not want to copy the entire site here.

1 posted on 04/09/2011 7:16:30 AM PDT by Pharmboy
[ Post Reply | Private Reply | View Replies]

To: thefactor; SunkenCiv; justiceseeker93; dennisw; Slings and Arrows

I was floored when I found this out...thought I would share.


2 posted on 04/09/2011 7:19:33 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy; SunkenCiv

Hey PB, nice post thanks. I had heard this many, many years ago from some linguists. Glad to see this guy(and you) bring it back to the light.


3 posted on 04/09/2011 7:20:17 AM PDT by mad_as_he$$
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy

Very interesting information. Not that I could ever use it. Which is on me, not you or the author.

BUT, this has raised some questions that you may be able to answer. (learning from others is what FR is all about)

I find it interesting that we (humans) created a variety of ways to scribe our words, instead of a uniform growth from the original ‘language’ and the characters used (what ever that was).

So, there are the English characters pretty much in use by all the romance languages, even Russian.

There are the Chinese and Japanese characters, which are similar, but not identical.

Here is where my question arises. Across the entire Middle East, what ‘characters’ do they use, and is there a ton of variety from country to country, tribe to tribe?

Is the Aramaic or modern Hebrew anything like the , say Iranian or Arab characters?


4 posted on 04/09/2011 7:33:12 AM PDT by UCANSEE2 (Lame and ill-informed post.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy


5 posted on 04/09/2011 7:33:53 AM PDT by JoeProBono (A closed mouth gathers no feet - Visualize)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Pharmboy; SJackson; Nachum; Zionist Conspirator

Pinging the experts...


6 posted on 04/09/2011 7:41:56 AM PDT by Slings and Arrows (You can't have Ingsoc without an Emmanuel Goldstein.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Pharmboy

This is not news to Jews!

http://www.jewfaq.org/alephbet.htm

...K’tav Ivri: Ancient Hebrew Script

As mentioned above, the Hebrew alphabet that we use today is referred to as Assyrian Script (in Hebrew, K’tav Ashuri). But there was once another way of writing the alphabet that the rabbis called K’tav Ivri, which means “Hebrew Script.” Many examples of this ancient way of writing the Hebrew alphabet has been found by archaeologists: on coins and other artifacts. It is quite similar to the ancient Phoenician writing. An example of this script is seen at Scripts of the Hebrew Language, side-by-side with other styles of Hebrew writing that were discussed above.

The rabbis of the Talmudic period were well aware of this ancient K’tav Ivri, and they raised the question whether the Torah was originally given in K’tav Ivri or K’tav Ashuri. A variety of opinions are expressed in the Talmud at Sanhedrin 21c-22a: one opinion states that the Torah was originally given in K’tav Ivri, but was changed to K’tav Ashuri in the days of Ezra, after the Babylonian Exile (the Babylonians, and consequently the Jews in exile, used K’tav Ashuri). Another opinion says that the Torah was written in K’tav Ashuri, but that holy script was denied the people when they sinned and was replaced with another one; when the people repented, the K’tav Ashuri was restored. A third opinion states that the Torah was always in K’tav Ashuri.

The general consensus is that the Torah was given in K’tav Ashuri, because the Talmud makes other references that don’t make sense in K’tav Ivri. The Talmud talks about final forms of letters in the original Torah, but K’tav Ivri doesn’t have final forms. It talks about the center of the Samekh and the Final Mem miraculously floating when the Ten Commandments were carved all the way through the tablets, but there is no Final Mem in K’tav Ivri, and neither Samekh nor Mem would have a floating center in K’tav Ivri as they do in K’tav Ashuri.

All authorities maintain that today, the only holy script is K’tav Ashuri. Any torah scrolls, tefillin or mezuzot must be written in K’tav Ashuri, and specifically in a style of K’tav Ashuri known as STA”M, discussed above.

K’tav Ivri is understood to be in the nature of a font, like Rashi script, rather than in the nature of a different alphabet, like Greek, Cyrillic or Roman. The names of the letters, the order of the letters, and the numerical value of the letters are apparently the same in both K’tav Ashuri and K’tav Ivri; thus, any religious significance that would be found in the numerical value of words or the sequence of the alphabet is the same in both scripts...


7 posted on 04/09/2011 7:47:24 AM PDT by jjotto ("Ya could look it up!")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy

8 posted on 04/09/2011 7:49:28 AM PDT by Ezekiel (The Obama-nation began with the Inauguration of Desolation.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: jjotto

Oh...and there’s an entry in wiki, too. Perhaps you should have said known to some Jews. Most do not know this; I am a Jew and none of my Jewish friends or family knew this. You are an exception, and I take my hat off to you...


9 posted on 04/09/2011 8:09:05 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 7 | View Replies]

To: Pharmboy
Jeff Benner has developed additional resources:
http://www.ancient-hebrew.org/
10 posted on 04/09/2011 8:14:39 AM PDT by yatros from flatwater
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy

Jesus spoke Aramaic, and probably spoke a little of other ancient langugages as well, given that he was among speakers of other languages. This is not surprising. Arabic, Hebrew and Aramaic are as related as French, Italian, and Spanish are to each other.


11 posted on 04/09/2011 8:17:03 AM PDT by Mamzelle
[ Post Reply | Private Reply | To 1 | View Replies]

To: UCANSEE2
Well, the most common Semitic alphabet in use today is Arabic and it too has evolved over the centuries as it was adapted and applied to different languages, including non-Semitic such as Persian, Turkic, etc. One of Kemal Attaturk's major reforms in Turkey was wholesale adoption of the Latin alphabet and, outside of old Ottoman materials and religious signed and texts, that today is all one sees.

I studied Arabic many years ago and can still sound out words and speak a little bit but don't know whether the alphabet follows the same sequence with the same or similar numeric values as Hebrew. I do recall from history classes that by the time of the Arab conquest (7th and 8th centuries) Hebrew was a solely liturgical language and completely out of use as a daily spoken tongue, and that the same was true in the time of Christ (He likely spoke in Aramaic and his contemporary fellow Jews would have used a good deal of Greek and Latin as well). I was taught that the grammar of modern spoken Hebrew had to be reinvented following Arabic rules and developed under the Moors in Andalusia (Spain) whose government administration over Spain relied heavily on the far better educated Jews among them.

What I have a hard time understanding from this article is why the "consensus" of opinion among Torah scholars is that a script which, even in its name "Ashura", is so clearly related to the Assyrian conquest and Babylonian Captivity would be the "original" used to write the oldest versions of the Torah, versus what seems to be a more ancient script the name of which derives from "Hebrew". Just doesn't make sense in terms of well established historic chronology.

12 posted on 04/09/2011 8:26:44 AM PDT by katana
[ Post Reply | Private Reply | To 4 | View Replies]

To: katana

“signs”, not “signed”


13 posted on 04/09/2011 8:27:40 AM PDT by katana
[ Post Reply | Private Reply | To 12 | View Replies]

To: yatros from flatwater
Thanks much for that link...I'm sure my friend knows about it. Very interesting.

One of the main reasons he started the site was to show the Five Books of Moses that he has painstakingly written in ancient Hebrew. He is now working on a second scroll.

14 posted on 04/09/2011 8:27:56 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Ezekiel

Wow! Thanks so much for jogging my memory about that movie. I guess they did their research...


15 posted on 04/09/2011 8:29:16 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Pharmboy

I am not Jewish, but have close ties to a number of Jewish scholars, and I can mostly thank Dr. Jonathon Paradise, from whom I learned Hebrew.


16 posted on 04/09/2011 8:31:45 AM PDT by jjotto ("Ya could look it up!")
[ Post Reply | Private Reply | To 9 | View Replies]

To: Pharmboy

ping


17 posted on 04/09/2011 8:38:44 AM PDT by wintertime
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy

I took Hebrew as my second language in college. One of my friends was a linguistics major so I thought I’d go to the same class as him. I ended up auditing it. I did however learn to recite the Hebrew alphabet to the tune of Boomer Sooner. Stay thirsty my friends.


18 posted on 04/09/2011 8:51:25 AM PDT by optiguy (Government does not solve problems; it subsidizes them.----- Ronald Reagan)
[ Post Reply | Private Reply | To 1 | View Replies]

To: jjotto
Interesting...I was educated in a Hebrew school and never had heard this. My Israeli friend attests to the fact that most Israeli Jews do not know this.

I believe that the rabbis do not disseminate this fact for a number of reasons (perhaps not wanting to admit that the alphabet they are using now was of non-Jewish origins being the main one), but language scholars (whether Jewish, Christian or Buddhist, without religious agendas) would have no reason not to speak of this fact.

19 posted on 04/09/2011 8:55:44 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 16 | View Replies]

To: optiguy

The Most Interesting Guy in the World
20 posted on 04/09/2011 9:01:00 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 18 | View Replies]

To: Pharmboy

Rabbis do indeed speak of this subject. It inevitably shows up in the Daf Yomi and every year in the parshas Yitro and Vaeschanan, although I guess that depends on who your rabbi is and to what extent the congregation actually studies the parsha. But you can’t get much by yeshiva bochurs, by omission or commission!


21 posted on 04/09/2011 9:06:47 AM PDT by jjotto ("Ya could look it up!")
[ Post Reply | Private Reply | To 19 | View Replies]

To: jjotto
LOL! (comment about yeshiva bochurs of which I was one). And certainly, rabbis speak of it, but not much among their congregations; perhaps in more scholarly pursuits.

I remember more than 50 years ago when in shul (temple) with my dad and he told me that the Jewish prayer for the dead (kaddish) was not Hebrew but Aramaic. He was, of course, referring to the language and not the alphabet; but, I am certain he went to his grave not knowing that the alphabet for all the prayer books and torahs we looked at over the years were in the Aramaic alphabet.

22 posted on 04/09/2011 9:17:08 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Pharmboy

Interesting. I have heard this before, but thanks for bringing it back up again.


23 posted on 04/09/2011 9:18:36 AM PDT by DeoVindiceSicSemperTyrannis (Want to make $$$? It's easy! Use FR as a platform to pimp your blog for hits!!!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy

When I studied beginning Hebrew in Seminary, we spent an hour or so of the first day in class discussing the original Hebrew script. But since the BHS (and the masoretic text) uses the modern script, we spent the following three years using that. Wyee du naught yuse olde Englysh scrypte eyther.


24 posted on 04/09/2011 9:25:35 AM PDT by Guyin4Os (A messianic ger-tsedek)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Guyin4Os
...but the Germans still do (at least when I took Deutsch in high school).

And, Jews using the Aramaic alphabet for the Hebrew language has been going on for more than 2,000 years. My point was other than persons like you and a few others who posted here who took Hebrew in college or are language scholars, the average guy/gal, Jew/Christian is not likely to know this.

25 posted on 04/09/2011 9:35:22 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Pharmboy; mad_as_he$$; GonzoII; StayAt HomeMother; Ernest_at_the_Beach; 1010RD; 21twelve; ...

· GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach ·
· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
 Antiquity Journal
 & archive
 Archaeologica
 Archaeology
 Archaeology Channel
 BAR
 Bronze Age Forum
 Discover
 Dogpile
 Eurekalert
 Google
 LiveScience
 Mirabilis.ca
 Nat Geographic
 PhysOrg
 Science Daily
 Science News
 Texas AM
 Yahoo
 Excerpt, or Link only?
 


Thanks Pharmboy, and mad_as_he$$ for the additional ping. And here's the buried lead:
When and why did the Aramaic/Assyrian script replace the Ancient Hebrew script?
To all -- please ping me to other topics which are appropriate for the GGG list.
 

· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword ·


26 posted on 04/09/2011 9:47:40 AM PDT by SunkenCiv (Thanks Cincinna for this link -- http://www.friendsofitamar.org)
[ Post Reply | Private Reply | View Replies]

http://www.freerepublic.com/focus/news/1772219/posts?page=42#42


27 posted on 04/09/2011 9:57:21 AM PDT by SunkenCiv (Thanks Cincinna for this link -- http://www.friendsofitamar.org)
[ Post Reply | Private Reply | View Replies]


28 posted on 04/09/2011 10:22:46 AM PDT by SunkenCiv (Thanks Cincinna for this link -- http://www.friendsofitamar.org)
[ Post Reply | Private Reply | View Replies]


29 posted on 04/09/2011 10:34:02 AM PDT by SunkenCiv (Thanks Cincinna for this link -- http://www.friendsofitamar.org)
[ Post Reply | Private Reply | View Replies]

To: Pharmboy
Interesting. I just started reading Hoffman's history of the Hebrew language, In the Beginning. So I guess I'll get to see what he has to say about this.

ML/NJ

30 posted on 04/09/2011 11:00:05 AM PDT by ml/nj
[ Post Reply | Private Reply | To 1 | View Replies]

To: ml/nj

My favorite translation of the Holy Bible is George M. Lamsa’s “Translations from the Aramic of the Peshitta.
This translation is from the ancient Eastern text.
You can read the whole thing on line, just google Lamsa Bible.


31 posted on 04/09/2011 11:08:07 AM PDT by Cowgirl
[ Post Reply | Private Reply | To 30 | View Replies]

To: ml/nj

Probably a lot to say...let us know.


32 posted on 04/09/2011 11:10:54 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Pharmboy

This entire discussion makes me feel so stupid, and it is giving me a headache! I studied French, Italian, and Spanish a barely remember a word of it. **sigh**

Thanks for the interesting post, even though I barely understand it.

BTW, when I was in college (the first time) a requirement for an MD was a proficiency in Latin, Greek, or German. There was an exam that everybody had to take. Whatever happened to that? I doubt that any doctors have to pass those language requirements any more.


33 posted on 04/09/2011 11:32:46 AM PDT by afraidfortherepublic
[ Post Reply | Private Reply | To 32 | View Replies]

To: katana; All

The victory of the victors model is probably based on the fact that usually the collaborators fare better in a conquest situation, and thus end up on top even when the conquest has been overcome/lifted.


34 posted on 04/09/2011 11:50:22 AM PDT by gleeaikin
[ Post Reply | Private Reply | To 12 | View Replies]

To: afraidfortherepublic
I graduated college and entered a US medical school in the late '60s (and yes, I graduated). At that time, they only required two years foreign language (Spanish, French, German, Latin, Greek and perhaps a few others also qualified). The only people in my class who took Latin were the ones who went to Catholic school.

And there continues to be the test that we took back then: the MCAT (Medical College Admission Test).

And thanks for your kind words.

35 posted on 04/09/2011 11:59:10 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 33 | View Replies]

To: UCANSEE2

I can answer this aas I am of Lebanese origin. Most of the semitic languages including modern hebrew, are all derived from canaanite I believe. Lebanon’s official language was aramaic until it changed to arabic I think during the Ottoman occupaiton. There are alot of forms of the language and I believe the Maronite church performs liturgy in Aramaic (or Syriac, which is also a very close derivation). All semitic languages have similarities. There are very many similarities between syriac, aramaic and hebrew much in the same way that there are similarities between latin and say italian where you can practically guess what a word means because the roots of the word in both languages is the same.
I dont speak syriac or aramaic but I do have a decent grasp on Lebanese Arabic. I say Lebanese mainly because its a much different accent when spoken than gulf arabic. Also, Lebanese has many words influenced by French and Turkish because well combined those countries had the region for like 500 years.
an example of similarities between aramaic arabic and hebrew.

English: Peace , house
Arabic: Salam , Beit
Aramaic: Shlomo , beita
Hebrew: Shalom , bayit

As for the characters of Arabic. They are the same in most countries, egypt for example have an extra letter which sounds like “G”. other arab countries dont use this letter, instead they pronounce it like “J”. Technically its just a pronounciation difference (which does sound very different) but they use a different character for it which is like the arabic “J” character but with an extra dot. Although not Arabic; Urdu uses alot of the same characters with several extra ones but I believe the relationship between the languages is far removed. I remember having a conversation with a pakistani, and he said he could read the quran in arabic(due to the similarity in the alphabet) but he doesnt understand anything. Accents in the arab world basically are different and you can tell the difference simply from the way a person speaks.

The characters of aramaic hebrew and arabic are pretty different with aramaic looking closer to hebrew than arabic. The letters correspond to one another though and basically when a Hebrew speaking person says alaph, it means a character in hebrew and it also is the name of a charcter in arabic and aramaic yet they are just written differently.
Ok well thats the most that I know, and I dont think there is any sort of organization to what I wrote, I just spewed out what was in my head :P


36 posted on 04/09/2011 12:46:48 PM PDT by hannibaal
[ Post Reply | Private Reply | To 4 | View Replies]

To: Pharmboy

I was referring to the mid-fifties. (or late 40s, since my info came from my parents). You can’t imagine how many (otherwise) qualified people by-passed the medical program because of the requirement that they be proficient in Greek, Latin, or German. Certainly my French background kept me from even considering it.

I wonder if those pre-requisites were dropped because of Viet Nam? Many requirements were reduced during the 60’s just to keep the best and the brightest in school.

Congratulations!


37 posted on 04/09/2011 3:06:19 PM PDT by afraidfortherepublic
[ Post Reply | Private Reply | To 35 | View Replies]

To: hannibaal
Thank you for adding to the quality of this thread with your informed reply.

Just to follow up: do the Iranians also use the Arabic alphabet?

38 posted on 04/09/2011 3:53:51 PM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 36 | View Replies]

To: hannibaal; NYer; Pharmboy

>>I believe the Maronite church performs liturgy in Aramaic (or Syriac, which is also a very close derivation).

As I understand it, Maronites do perform their liturgy in Aramaic. NYer might know better.

Very interesting post Pharmboy.


39 posted on 04/09/2011 4:56:18 PM PDT by Betis70 (UConn!)
[ Post Reply | Private Reply | To 36 | View Replies]

To: Betis70

I have taught several Marionite Arabs in the Galilee area, and it is my understanding that they pray in Arabic.


40 posted on 04/10/2011 2:35:07 AM PDT by Yadan ((Reuven))
[ Post Reply | Private Reply | To 39 | View Replies]

To: Pharmboy

Thanks for the post.


41 posted on 04/10/2011 3:05:17 AM PDT by Cvengr (Adversity in life and death is inevitable. Thru faith in Christ, stress is optional.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy

FWIW,...

I personally believe otherwise.

Hebrew has been described as the flaming language.

It’s origins also came from the Aramaic as recorded by humans.

About a decade ago I had dreams in Hebrew, then in Ancient Aramaic, first a few characters, but I did not know the alphabet. I didn’t recognize them from my studies, but could recall them when awake, and researched various alphabets for similarities, when I discovered their roots in Hebrew and later in Ancient Arabic scripts.

IMHO, their original source were are a written form of communication which probably was engraved by Hebrew Prophets, i.e. those who were to communicate from God to man, from spiritual experience.

In later dreams, I would be shown some Hebrew word and immediately would understand its meaning in my heart. I associate this with how God the Holy Spirit may manifest His work to glorify the Son in communicating directly to our human spirit, which may then be used to sanctify our soul, and when processed by our recall of other sanctified doctrine rejuvenates and sanctifies our heart.

I do not know all their meanings, but even each character is associated or identifiable with a meaning.

I’m intrigued by their study, but more importantly, we are to remain in fellowship with Him, so that He grows us as He wills, to be at the right time, in the right place, to perform according to His will, through faith in what He provides.

God Bless.

Interesting article and responses.


42 posted on 04/10/2011 3:32:03 AM PDT by Cvengr (Adversity in life and death is inevitable. Thru faith in Christ, stress is optional.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Yadan

Welcome to Free Republic!


43 posted on 04/10/2011 4:46:52 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 40 | View Replies]

To: Pharmboy; jjotto; hannibaal; gandalftb; nuconvert; Dajjal

Language related links:

“Ancient” Syriac bible found in Cyprus
http://www.freerepublic.com/focus/f-religion/2179793/posts

Low profile for German Koran challenger
http://www.freerepublic.com/focus/f-news/1277705/posts

Ancient Islamic Texts Resurface (Impugning The Legitimacy of the Koran,Islam)
http://www.freerepublic.com/focus/f-news/1956189/posts


44 posted on 04/10/2011 5:18:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Pharmboy
Just to follow up: do the Iranians also use the Arabic alphabet?

The Persian language has been written with a number of different scripts, including the Old Persian Cuneiform, Pahlavi, Aramaic, and Avestan, Cyrillic and Latin alphabets. After the Islamic conquest of the Persian Sassanian Empire in 642 AD, Arabic became the language of government, culture and especially religion.
Just to follow up: do the Iranians also use the Arabic alphabet?

Modern Persian appeared during the 9th century. It is written in a version of the Arabic script and is full of words of Arabic origin. There are also two methods of writing Persian with the Latin alphabet.

Under Mongolian and Turkish rulers, Persian was adopted as the language of government in Turkey, central Asia and India, where it was used for centuries, and until after 1900 in Kashmir.

Persian is a member of the Iranian branch of Indo-European languages spoken by about 130 million people, mainly in Iran, Afghanistan and Tajikistan. There are also significiant numbers of speakers in many other countries, including Uzbekistan, Bahrain, Iraq, Turkey, Kuwait, Azerbaijan, Israel, Turkmenistan, Oman, Yemen, the UAE and the USA.

http://www.omniglot.com/writing/persian.htm

45 posted on 04/10/2011 5:24:37 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 38 | View Replies]

To: Cvengr

You say:

“It’s origins also came from the Aramaic as recorded by humans.”

I’d like to know which humans recorded this. What you personally believe is your complete right, but historical, linguistic and calligraphic research does not back you up. Facts are facts!


46 posted on 04/10/2011 6:25:55 AM PDT by Yadan ((Reuven))
[ Post Reply | Private Reply | To 42 | View Replies]

To: Pharmboy

Thanks for your welcome; a pleasure to participate!


47 posted on 04/10/2011 6:25:55 AM PDT by Yadan ((Reuven))
[ Post Reply | Private Reply | To 43 | View Replies]

To: Yadan

You are probably correct. The Catholic Encyclopedia suggests that their liturgy is normally performed in Syriac, but that many priests say it in Arabic.

http://www.newadvent.org/cathen/09683c.htm

“The Maronite is a Syrian Rite, Syriac being the liturgical language, though the Gospel is read in Arabic for the benefit of the people. Many of the priests, who are not sufficiently learned to perform the Liturgy in Syriac, use Arabic instead, but Arabic written in Syriac characters (Karshuni). The liturgy is of the Syrian type, i.e., the liturgy of St. James, but much disfigured by attempts to adapt it to Roman usages.”


48 posted on 04/10/2011 7:36:45 AM PDT by Betis70 (UConn!)
[ Post Reply | Private Reply | To 40 | View Replies]

To: SunkenCiv
Thanks for taking the time to post these related links, SC. Some of them have terrific discussions.

You are a tireless disseminator of truth and light...and I think I speak for many in occasionally thanking you for helping to broaden our horizons.

49 posted on 04/10/2011 7:37:01 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 28 | View Replies]

To: AdmSmith

Thank you for answering my question so completely and adding to the value of this thread.


50 posted on 04/10/2011 7:40:13 AM PDT by Pharmboy (What always made the state a hell has been that man tried to make it heaven-Hoelderlin)
[ Post Reply | Private Reply | To 45 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-64 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson