Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Einstein Was Right, Again: Novel Experiment Proves Antigravity Doesn’t Exist
www.inverse.com ^ | SEP. 27, 2023 | BY KIONA SMITH

Posted on 10/06/2023 7:57:56 AM PDT by Red Badger

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-60 last
To: Leaning Right

If there is no such thing as antigravity, what causes my cow to occasionally fly up into the air?

Aliens are stealing them.


41 posted on 10/06/2023 9:43:55 AM PDT by telescope115 (I NEED MY SPACE!!! 🔭)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Ultra Sonic 007

Yeah the flat earthers definitely may have contributed to my inability to detect sarcasm when people post nonsense on science topics.


42 posted on 10/06/2023 9:45:41 AM PDT by Boogieman
[ Post Reply | Private Reply | To 40 | View Replies]

To: adorno; Boogieman
Still, it's very presumptuous for scientists to believe that anti-gravity is either an up or down force. It could be a sideways force movement. ;) Which way is up? In the universe, who knows?

Gravity as a force is determined by the mass of objects. Although it's no longer considered as precise as the theory of general relativity, Newton's law of universal gravitation still suffices in general for most purposes to help clarify how gravitational force between two objects occurs. (And we know there's merit to it, because Newton's law was used to determine the existence of a planet beyond Uranus in 1821, purely due to the fact that Uranus's observed orbit did not behave according to mathematical expectations. It was hypothesized that a sufficiently large planet existed beyond Uranus that was perturbing its orbit; lo and behold, Neptune was eventually discovered in 1846.)

In our particular case, 'up' is just a frame of reference we use relative to our position on Earth, because the mass of Earth overwhelms all other objects within our immediate vicinity. As such, the gravitational force exerted upon us by Earth 'pulls' us toward it. 'Anti-gravity', in this case, would be an inverted reaction between matter and antimatter, in the sense that gravitational interactions would not behave the same as they otherwise would. (In other words, it would not be a 'sideways force', but a lack of force altogether.)

If anti-gravity (as hypothesized for the purposes of the described experiment) existed, then antimatter would not be attracted by the mass of Earth (being made of matter), and would instead behave more or less randomly (since there aren't many objects made of pure anti-mass within the vicinity). However, based on the experiment, anti-matter behaved just like regular matter in terms of gravitational interaction, as it all was attracted in the direction of the greatest gravitational force within the proverbial neighborhood: namely, the Earth itself.

43 posted on 10/06/2023 9:52:58 AM PDT by Ultra Sonic 007 (There is nothing new under the sun.)
[ Post Reply | Private Reply | To 39 | View Replies]

To: Red Badger

This is kind of a good thing.

If you had an antigravity device, but it attracted antimatter to itself, seems like it would then be a pretty useless device as it would pretty quickly be annihilated.


44 posted on 10/06/2023 10:26:48 AM PDT by chrisser (I lost my vaccine card in a tragic boating accident.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Boogieman

Then wouldn’t Relativity tacitly support the notion of contra-gravity where the large mass is perceived to be moving towards the smaller mass? I would expect gravity not to be a quality/dimension of Relativity, but this topic is many decades old in my distant memory. All I recall is man walking inside a train that’s passing a platform — or something like that.


45 posted on 10/06/2023 10:33:26 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 34 | View Replies]

To: Red Badger
Yup, I agree. It could just as easily be said to undermine Einstein, rather than, as the breathless headline claims, prove he was right.

46 posted on 10/06/2023 10:35:47 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Gene Eric

“Then wouldn’t Relativity tacitly support the notion of contra-gravity where the large mass is perceived to be moving towards the smaller mass?”

No, because both masses are still attracting each other, so it’s just gravity, whether you look at it from a reference of you falling towards the earth or the earth falling towards you.

“All I recall is man walking inside a train that’s passing a platform — or something like that.”

The basic idea is that the laws of physics remain the same no matter what frame of reference you choose to view things from. So if there is no anti-gravity in one reference frame, there can’t be anti-gravity simply created as an effect of switching to another reference frame.


47 posted on 10/06/2023 10:41:26 AM PDT by Boogieman
[ Post Reply | Private Reply | To 45 | View Replies]

To: Red Badger

Awesome experiment...
Awesome result...

Albert rocks!
The more things change, the more they stay the same...


48 posted on 10/06/2023 10:50:14 AM PDT by SuperLuminal (Where is the next Sam Adams when we so desperately need him)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Magnum44

Thank you, my daughter will appreciate this meme as much as I do 😆


49 posted on 10/06/2023 10:55:38 AM PDT by Spacetrucker (George Washington didn't use his freedom of speech to defeat the British - HE SHOT THEM .. WITH GUNS)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Magnum44

BTTT!!!


50 posted on 10/06/2023 11:02:19 AM PDT by musicman (The future is just a collection of successive nows.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Red Badger

Gravity is not a traditional force, it’s a distortion of space-time.

Magnetism is a force but has no energy on its own.. it is a good way to convert energy from one form to another i.e. motion to electrical current.

If you could create a sheet of material that could block gravity or magnetism then you would have a perpetual motion machine... it just ain’t possible. It is as silly as the notion of pulling yourself up by the bootstraps...lol

As an aside, the best vehicle that can possibly be made given the current state of technology is a diesel-electric.
Purely battery powered cars await a breakthrough in battery technology that is not yet in sight (compact super-capacitor batteries of small size/weight with enormous capacity and rapid charge times)

A small, clean diesel drives an efficient generator to charge the batteries. The batteries drive the brushless motors in the wheel hubs. No normal braking system required as magnetic braking is excellent, no transmission needed, massive acceleration possible for short durations... no problems running a heater in winter or air conditioning in summer. No waiting to charge your car, it charges itself. You can drive on electric only for quite a few miles to cut pollution inside cities. Diesel is far safer in an accident compared to gasoline - much less danger of fire... i.e. The gas powered Sherman tank was a burning joke compared to German diesel tanks of WW2


51 posted on 10/06/2023 11:13:15 AM PDT by Bobalu (The political prosecution of Donald Trump marks the official end of US democracy.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Dark energy

I’m surrounded by it

Help!

I miss baryonic company


52 posted on 10/06/2023 11:14:10 AM PDT by wardaddy (Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Bobalu

https://en.wikipedia.org/wiki/Mu-metal


53 posted on 10/06/2023 11:15:12 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Red Badger

Dark energy

I’m surrounded by it

Help!

I miss baryonic company


54 posted on 10/06/2023 11:15:20 AM PDT by wardaddy (Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wardaddy

That’s odd.................


55 posted on 10/06/2023 11:20:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 52 | View Replies]

To: Boogieman

Appreciated :)


56 posted on 10/06/2023 11:35:44 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 47 | View Replies]

To: Red Badger

hysteresis loss and other considerations...

The idea of using Mu-metal to create a magnetic perpetual motion device is as silly as the notion of a flat Earth.

Never can such a device produce even the slightest amount of energy gain... it is always losing energy.

As far as energy production, all energy on the Earth comes from stars... our nearest star, Sol is a gigantic hydrogen-fusion source. If we can engineer a safe fusion reactor we will have virtually limitless energy. Fusion is the best energy production we can conceive of at this time... but even fusion power is not something-for-nothing, it is NOT a perpetual motion system.


57 posted on 10/06/2023 11:37:35 AM PDT by Bobalu (The political prosecution of Donald Trump marks the official end of US democracy.)
[ Post Reply | Private Reply | To 53 | View Replies]

To: Larry Lucido
Somebody has be experiencing abstinence.


58 posted on 10/06/2023 12:11:07 PM PDT by Gamecock ("The prosperity gospel is exactly like marrying someone for their money." -Sean Demars)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Magnum44

Borrowing that!


59 posted on 10/06/2023 9:26:05 PM PDT by Redcitizen
[ Post Reply | Private Reply | To 10 | View Replies]

To: Red Badger

Thank you for the article.


60 posted on 10/07/2023 2:33:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-60 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson