Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The Nobel Prize in Chemistry 2011 Daniel Shechtman (Israel)
The nobel Foundation ^ | oct 6, 2011 | staff

Posted on 10/05/2011 2:57:44 AM PDT by AdmSmith

The Royal Swedish Academy of Sciences has decided to award the Nobel Prize in Chemistry for 2011 to

Daniel Shechtman Technion - Israel Institute of Technology, Haifa, Israel

"for the discovery of quasicrystals"

A remarkable mosaic of atoms

In quasicrystals, we find the fascinating mosaics of the Arabic world reproduced at the level of atoms: regular patterns that never repeat themselves. However, the configuration found in quasicrystals was considered impossible, and Daniel Shechtman had to fight a fierce battle against established science. The Nobel Prize in Chemistry 2011 has fundamentally altered how chemists conceive of solid matter.

(Excerpt) Read more at nobelprize.org ...


TOPICS: Culture/Society; Extended News
KEYWORDS: chemistry; danielshechtman; iowa; israel; nobelprize; quasicrystals; stringtheory

1 posted on 10/05/2011 2:57:49 AM PDT by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: AdmSmith

http://www.nobelprize.org/nobel_prizes/chemistry/laureates/2011/info_publ_eng_2011.pdf

http://www.nobelprize.org/nobel_prizes/chemistry/laureates/2011/sciback_2011.pdf


2 posted on 10/05/2011 2:58:28 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; bvw; callisto; ckilmer; dandelion; ganeshpuri89; gobucks; KevinDavis; Las Vegas Dave; ...

Thanks AdmSmith.

· String Theory Ping List ·
Periodic Table of Rejected Elements
· Join · Bookmark · Topics · Google ·
· View or Post in 'blog · post a topic · subscribe ·


3 posted on 10/05/2011 3:07:23 AM PDT by SunkenCiv (It's never a bad time to FReep this link -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: AdmSmith

However, the configuration found in quasicrystals was considered impossible, and Daniel Shechtman had to fight a fierce battle against established science.

yay!


4 posted on 10/05/2011 3:07:26 AM PDT by ari-freedom (I'm a heartless conservative because I love this country.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; steelyourfaith; decimon; SunkenCiv; Billthedrill; Robert A. Cook, PE; Wonder Warthog; ...
Thanks, AdmSmith.

*PING*

*PING* to SteelYourFaith for a parallel example of "the science is settled."

5 posted on 10/05/2011 3:23:21 AM PDT by grey_whiskers (The opinions are solely those of the author and are subject to change without notice.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
...regular patterns that never repeat themselves.

Am I the only one to whom this phrase does not make sense?

6 posted on 10/05/2011 3:24:13 AM PDT by DuncanWaring (The Lord uses the good ones; the bad ones use the Lord.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
However, the configuration found in quasicrystals was considered impossible, and Daniel Shechtman had to fight a fierce battle against established science

Did he have to fight as hard as current scientists who are skeptical about global warming?

7 posted on 10/05/2011 3:42:59 AM PDT by paudio (0bama is like a bad mechanic who couldn't fix your car; he just makes it worse. Get somebody else!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DuncanWaring

Nope. Sounds almost like CNN, not chemistry.


8 posted on 10/05/2011 4:19:18 AM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith

In quasicrystals, we find the fascinating mosaics of the Arabic world reproduced at the level of atoms


Glad he got the award. But...notice that they had to stick the word “Arabic” in there?


9 posted on 10/05/2011 4:25:33 AM PDT by rbg81
[ Post Reply | Private Reply | To 1 | View Replies]

To: DuncanWaring

http://www.physics.emory.edu/~weeks/pics/icon.html


10 posted on 10/05/2011 4:49:33 AM PDT by Stosh
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith

Wow, for once an Israeli got a Nobel prize in science instead of a Palestinian. It’s about time.


11 posted on 10/05/2011 4:52:14 AM PDT by samtheman (Palin. In your heart you know she's right.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: grey_whiskers
Interesting. I'm sure "Mother Nature" still has MANY surprises in store for all fields of science, both in the large, and in the small. Anyone who claims "the science is settled" on ANY topic is dreaming.

Looks to me like many of the most firmly held theories are beginning to fray around the edges (symmetry, speed-of-light limit, and I'm sure many others I am not aware of).

12 posted on 10/05/2011 4:58:33 AM PDT by Wonder Warthog
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith

So let me see if I understand this:

One guy comes up with an idea, the whole rest of the world tells him he’s wrong and that the thing he says exists doesn’t exist and can’t exist because it’s impossible, and inconsistent with everything everybody “knows.” He’s driven away from the place where he works and has to go off by himself. 27 years later the thing he said existed, and that everybody else said couldn’t possibly exist, is found in nature. Luckily for him he’s still alive when everybody else in the world wakes up and realizes he was right after all.

The moral of the story could only have been clearer if the guy’s first name were Abraham.


13 posted on 10/05/2011 5:02:09 AM PDT by JOHN ADAMS
[ Post Reply | Private Reply | To 1 | View Replies]

To: betty boop; Alamo-Girl

I thought you ladies might be interested in this thread. After you visit maybe you can then explain it to me. :-)

http://www.nobelprize.org/nobel_prizes/chemistry/laureates/2011/info_publ_eng_2011.pdf


14 posted on 10/05/2011 10:40:59 AM PDT by Mind-numbed Robot
[ Post Reply | Private Reply | To 2 | View Replies]

To: Mind-numbed Robot

It’s absolutely fascinating, dear Mind-numbed Robot, thanks for the ping!


15 posted on 10/06/2011 9:59:03 PM PDT by Alamo-Girl
[ Post Reply | Private Reply | To 14 | View Replies]


Thanks AdmSmith.
16 posted on 10/07/2011 3:12:02 AM PDT by SunkenCiv (It's never a bad time to FReep this link -- https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: Mind-numbed Robot; Alamo-Girl; TXnMA; xzins
I thought you ladies might be interested in this thread. After you visit maybe you can then explain it to me. :-)

LOLOL dear MNR!!! Jeepers, I'm not a crystallographer, and have zero experience with experimentation by electron microscope!

Still, on the basis of the link you provided, it seems that conventional science has admitted the possibility of only certain symmetries in nature, topping out at six-fold symmetries. But I wonder whether there can be any x-fold symmetry, where 360 divided by x yields a positive integer. Shechtman's 10-fold symmetry would meet this test, the integer being 36. (But a 7-fold symmetry would not; the division produces a non-integer, 51.4285714.)

Just a speculation here....

Truly fascinating to me is the relevance of the Fibonnaci series and the golden ratio (tau) of mathematics to both quasicrystals and aperiodic mosaics. This tells me that fundamentally, real existing things "reduce" to mathematics. That is, the structural order of the world is, at bottom, mathematical/geometric.

Which would support the ancient idea of "God, Geometer." The etymology of the word "geometer" goes back to the ancient Greek, denoting "measurer of the Earth."

It turns out that these aperiodic quasicrystals that were assumed not to exist actually constitute valuable new materials that we now use in daily life (i.e., Teflon).

But for me, the main takeaway of the article is summed up very well in the final paragraph: "...even our greatest scientists [e.g., Linus Pauling] are not immune to getting stuck in convention. Keeping an open mind and daring to question established knowledge may in fact be a scientist’s most important character traits."

Amen to that!

Thank you so much, dear MNR, for the fascinating link!

17 posted on 10/08/2011 11:56:06 AM PDT by betty boop (We are led to believe a lie when we see with, and not through, the eye. — William Blake)
[ Post Reply | Private Reply | To 14 | View Replies]

To: betty boop
Truly fascinating to me is the relevance of the Fibonnaci series and the golden ratio (tau) of mathematics to both quasicrystals and aperiodic mosaics.

Yeah, that is what I noticed, too. :-)

My take away was similar to yours - when we think we know it all, we don't. There is still much more to be revealed when we are ready for it.

18 posted on 10/08/2011 5:37:30 PM PDT by Mind-numbed Robot
[ Post Reply | Private Reply | To 17 | View Replies]

To: betty boop

Speaking of crystals ...

http://www.guardian.co.uk/science/2011/oct/07/huge-investment-graphene-nobel-prizewinner


19 posted on 10/08/2011 9:08:33 PM PDT by Mind-numbed Robot
[ Post Reply | Private Reply | To 17 | View Replies]

To: betty boop; Mind-numbed Robot; TXnMA; xzins
This tells me that fundamentally, real existing things "reduce" to mathematics. That is, the structural order of the world is, at bottom, mathematical/geometric.

Indeed. And it brings to mind Max Tegmark's Level IV parallel universe model which posits that observables are manifestations of mathematical structures which actually do exist beyond space/time.

Thank you so much for sharing your insights, dearest sister in Christ!

20 posted on 10/08/2011 10:08:45 PM PDT by Alamo-Girl
[ Post Reply | Private Reply | To 17 | View Replies]

To: Alamo-Girl; Mind-numbed Robot; TXnMA; xzins
...it brings to mind Max Tegmark's Level IV parallel universe model which posits that observables are manifestations of mathematical structures which actually do exist beyond space/time.

Indeed — and such a fascinating insight! It is actually amazingly "platonic," too. To me, Tegmark's mathematical structures directly correlate with Plato's forms, which are inherently mathematical, and the (divine) Idea of which they are manifestations.

In Plato's creation myth, the Demiurge — who is not the One God "Beyond" the Cosmos, but seemingly a sort of agent of the Divine — "persuades" the pure, unlimited potentiality of Chora (i.e., matter) — which, being unformed and random is literally "no-thing" — to accept "formation," to conform to a "limit," such that it can become a "some-thing" existent in actual Reality. The Demiurge is motivated to create all things according to the very standards of truth, goodness, beauty, and justice — that is, according to the divine Idea, in a manner consistent with the true nature of the One God.

The point is, the creative "forms" of Plato's Demiurge, who acts for the One God "Beyond" the Cosmos, are mathematical/geometrical in nature. [It is generally agreed that Plato was a student of Pythagoras, for whom number and geometry were the keys to unlocking all the "mysteries" of the universe.]

"Random" matter can manifest no particular existence until or unless it can be "persuaded" to accept formation by such means. I gather Plato's insistence that the Demiurge works by means of "persuasion" — peitho — indicates his reluctance to believe that we live in a completely deterministic universe.

Anyhoot, I find Plato's creation myth (found in the Timaeus) to be eminently fascinating. Somehow I draw a correspondence/resemblance between his Chora and the pure potentiality of the quantum world....

I greatly admire Max Tegmark, a mathematician of the Platonist "school." He is no mathematical formalist like, say, David Hilbert, or Bertrand Russell.

I imagine that if, in fact, such mathematical structures exist beyond the 4D spacetime that humans normally experience, they must do so from yet another "timelike" dimension "above" the four nominal dimensions of human direct experience....

Anyhoot, to my way of thinking, these are fascinating conjectures.

They are also entirely beyond the reach of the scientific method.

But does this fact make them necessarily "untrue?"

I don't think so.

Thank you ever so much, dearest sister in Christ, for bringing Max Tegmark's Level IV parallel universe to mind!

21 posted on 10/11/2011 11:25:26 AM PDT by betty boop (We are led to believe a lie when we see with, and not through, the eye. — William Blake)
[ Post Reply | Private Reply | To 20 | View Replies]

To: betty boop
It is generally agreed that Plato was a student of Pythagoras, for whom number and geometry were the keys to unlocking all the "mysteries" of the universe.

And that point holds today for all investigations which exclude philosophy and theology on principle (methodological naturalism) - as this article attests.

Thank you oh so very much for your wonderful essay-post, dearest sister in Christ!

22 posted on 10/11/2011 1:18:40 PM PDT by Alamo-Girl
[ Post Reply | Private Reply | To 21 | View Replies]

To: betty boop
I imagine that if, in fact, such mathematical structures exist beyond the 4D spacetime that humans normally experience, they must do so from yet another "timelike" dimension "above" the four nominal dimensions of human direct experience....

Depends on how strictly you define "experience." I think we can broaden our experience through our faith in and openness to God and the depth of our interest. As we agreed, mathematics is a language which helps us see and express relationships among the "observables" and to some extent to predict future relationships. As we do those things aren't we experiencing them?

From the Pythagorean Theorem to the Fibonacci numbers we are simply observing preexisting patterns, or forms. Do those observations evoke a sense of awe or just an amused recognition like, "Hey, look at that! That's weird!" If the latter, that is normal. If the former, we are beginning to peel away the layers of reality.

As we learn about DNA, RNA, nutrition, etc., we are also looking deeper into reality, if we care to. My point is that all this already exists but we are slowly learning about some of it. As some is revealed more will be revealed, but it is already there. We are just experiencing it at different times and in different ways.

That reminds me of one of my favorite definitions: Expert - One who knows a lot about a little, or more and more about less and less.

Anyhoot, to my way of thinking, these are fascinating conjectures.

They are also entirely beyond the reach of the scientific method.

We can thank Free Will and decisions made in the Garden of Eden for that. God set it all in place and gave us the secret to it all. We just keep looking for it in all the wrong places. We concentrate on the nouns, the observables, and ignore God, the Verb. Concentrating on the nouns is not bad for that leads to our earthly, physical progress. Ignoring God the verb leaves us wondering in the wilderness in search of that which surrounds us.

The Bible is a wonderful allegory which leads us to the answers. We simply need to let it lead us.

23 posted on 10/12/2011 9:14:51 AM PDT by Mind-numbed Robot
[ Post Reply | Private Reply | To 21 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson