Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Choir to sing the 'code of life'
BBC ^ | 10 July 2010 | Pallab Ghosh

Posted on 07/18/2010 9:15:04 AM PDT by annie laurie

Scientists and composers have produced a new choral work in which performers sing parts of their own genetic code.

Human DNA is made up of just four different chemical compounds, which gave musician Andrew Morley the idea of assigning a note to each of them.

The new piece, Allele, will be performed by the New London Chamber Choir at the Royal Society of Medicine on 13 July.

Each of the 40-strong choir has also had his or her own DNA decoded.

"I'd sung quite a lot with choirs in my youth and I've written stuff myself, and so I was aware that note sequences look a little bit like genetic sequences," explained Dr Morley.

"It took a consultation with a proper composer to find out that was indeed the case, and that it would be possible to create something from genetic sequences."

...

Members of the 40-strong choir are all participants in a scientific study.

Each of them has had his or her DNA decoded in order to see what it is genetically that distinguishes great singers from the rest of us.

That science is yet to be published; but in the meantime, almost as a spin off, Michael Zev Gordon has turned a simple idea into a beautiful work of art through his imaginative arrangement and use of rhythm.

To begin with, there is a single voice singing a simple rhythmic phrase; but as the piece develops, more voices join in - conveying the biological idea of replication and reproduction.

At its climax, each member of the choir is singing their own unique genetic code - resulting in everyone singing a subtly different song.

...

(Excerpt) Read more at bbc.co.uk ...


TOPICS: Music/Entertainment; Science
KEYWORDS: 2stupid4words; allele; choir; chorale; dna; godsgravesglyphs; helixmakemineadouble
Interesting concept.
1 posted on 07/18/2010 9:15:06 AM PDT by annie laurie
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; neverdem

Ping of possible interest.


2 posted on 07/18/2010 9:16:47 AM PDT by annie laurie (All that is gold does not glitter, not all those who wander are lost)
[ Post Reply | Private Reply | To 1 | View Replies]

To: annie laurie

btt


3 posted on 07/18/2010 9:26:33 AM PDT by mnehring
[ Post Reply | Private Reply | To 1 | View Replies]

To: annie laurie; Godzilla

I remember a group of Japanese girls singing the chorus to the genetic code of a prehistoric plant.

They ended up pi$$ing off baby Godzilla and awakening Rodan.


4 posted on 07/18/2010 9:32:53 AM PDT by RandallFlagg (30-year smoker, E-Cigs helped me quit, and O wants me back smoking again?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: annie laurie

There is a popular workshop that translates your individual horoscope into the warp and weft of a weaving pattern. These patterns are physically set down in a manner resembling notes on a piece of sheet music. The lines represent the woof and the “notes,” the weft and the order in which you pull the harnesses. I suppose you could sing that as well - or, you might weave the allele pattern. It is all mathematics.


5 posted on 07/18/2010 9:34:36 AM PDT by marsh2
[ Post Reply | Private Reply | To 1 | View Replies]

To: annie laurie; martin_fierro

· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
Gods
Graves
Glyphs
Thanks annie laurie. To all -- please ping me to other topics which are appropriate for the GGG list.
GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach
 

·Dogpile · Archaeologica · Mirabilis.ca · LiveScience · Biblical Archaeology Society ·
· Discover · Bronze Age Forum · Science Daily · Science News · Eurekalert · PhysOrg ·
· Nat Geographic · Texas AM Anthro News · Yahoo Anthro & Archaeo · Google ·
· Archaeology · The Archaeology Channel · Excerpt, or Link only? · cgk's list of ping lists ·
· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword · ·


6 posted on 07/18/2010 9:59:02 AM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 2 | View Replies]

To: annie laurie; SunkenCiv
ATTAGATAAAGAGAGATTATTAAAATTGGG


7 posted on 07/18/2010 5:56:04 PM PDT by martin_fierro (< |:)~)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson