Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

The Discovery Of ‘Mass Graves’ Of Indigenous Canadian Children Was Actually A Massive Hoax
The Federalist ^ | 05/10/2024 | John Daniel Davidson

Posted on 05/10/2024 9:32:03 AM PDT by SeekAndFind

Three years after reports of indigenous mass graves triggered the torching or vandalism of 85-plus churches, no graves have been found.

Three years ago, a major story broke in Canada that seemed to confirm every left-wing prejudice against Christians imaginable: A mass grave containing the remains of indigenous children was supposedly discovered on the grounds of what had once been a government boarding school run by the Catholic Church.

It turns out the whole thing was a hoax, a modern-day blood libel against Christians that ended with at least 85 Catholic churches across Canada destroyed by arson, vandalized, or desecrated. Canadian political and civil society leaders cheered on this destruction — and then doled out hundreds of millions of dollars to investigate the mass graves and create a “support fund” for indigenous people.

To this day, no human remains have been recovered at the site of the alleged mass grave, despite nearly $8 million spent looking for them.

You won’t hear the corporate press report on this story now, but in the summer of 2021, it was everywhere. And no wonder, it had all the elements of a just-so story. The mere historical existence of these former boarding schools, which operated from the 1860s to the 1990s, remains a source of outrage among liberal Canadians. The residential school system, as it was called, often separated indigenous Canadian children from their families and communities, forcing them to attend chronically underfunded government schools, the purpose of which was to assimilate and acculturate indigenous Canadians into European Canadian society.

The history here was bad enough — a racist outrage, as far as Canadian liberals were concerned. But then came news of the mass graves. The Catholic priests and nuns who ran the Kamloops Indian Residential School in British Columbia had, it seemed, callously discarded the corpses of hundreds of dead schoolchildren in mass graves on the school grounds. Or so said the Tk’emlúps te Secwépemc First Nation, which claimed that ground-penetrating radar had revealed the remains near the site of the former school.

In a healthy society, an explosive claim of this sort would have been subject to at least some critical scrutiny. But Canada, like the U.S., is not a healthy society. Major outlets like CNN, NPR, and the Canadian Broadcasting Corporation simply regurgitated the claim as a verified fact, couching their coverage in the most hyperbolic terms possible. CNN called it an “unthinkable” discovery. The Washington Post declared the story had “dragged the horror of Canada’s mistreatment of Indigenous people back into the spotlight.” 

Canadian politicians followed suit. Prime Minister Justin Trudeau ordered flags to be lowered to half-mast and demanded Pope Francis come to Canada and apologize (which he did, a year later). Trudeau said the discovery “is a painful reminder of that dark and shameful chapter of our country’s history.” British Columbia Premier John Horgan said he was “horrified and heartbroken.” The Office of the United Nations High Commissioner for Human Rights said it was “a large scale human rights violation,” and called on Canada and the Vatican to investigate.

Canadian tribal leaders went further, saying the purported discovery was evidence of “mass murder of indigenous people,” and an “attempted genocide.” They compared the priests and nuns who ran these schools to Nazis.

Amid this escalating rhetoric came the arson. Churches across Canada, most of them Catholic and some more than a century old, were burned to the ground in retaliation. Not a few of the targeted churches belonged to indigenous congregations. Many of them were beautiful, historic churches. One was a Coptic Orthodox Church — never mind that the Coptic Orthodox Church had no historical connection to Canada’s residential schools. Churches that weren’t completely destroyed were vandalized, many of them with the words “charge the priests” scrawled in red paint.

In many cases, local law enforcement had no comment. Trudeau said he understood the anger driving the attacks. Harsha Walia, the executive director of the British Columbia Civil Liberties Association, tweeted, “Burn it all down.”

It was pretty obvious at the time that this was all a moral panic, ginned up by an indigenous tribe and cheered on by liberal elites who hate Western civilization in general and Christianity in particular. As my erstwhile Federalist colleague Chris Bedford reported at the time, the mass unmarked grave at Kamloops, and the hundreds of other such graves supposedly discovered at the site of other former schools that summer, were not what the outraged left said they were.

In almost every case, they weren’t mass graves, but individual graves, and they were located in cemeteries. “The reason the graves are ‘unmarked’ is that the wooden crosses used to mark them and the fence that kept them safe decayed,” Bedford wrote. “In other words, people have found that an old cemetery contained bodies.” It’s worth noting that they used wooden crosses because the government refused to pay for headstones. It’s also worth noting that these cemeteries don’t just contain the graves of schoolchildren but also of priests and nuns and other members of these communities. Indeed, many of these old cemeteries with unmarked, individual graves, were detailed in a Truth and Reconciliation Commission report released nearly a decade ago.

So there was no cover-up and no mass graves, just a complicated and nuanced history. But it’s a history Canada’s ruling political and media elite aren’t interested in exploring honestly.

Today, nearly three years after dozens of churches across Canada (and a few in the U.S.) were destroyed, there is not a shred of physical evidence for the claims that kicked off the hoax, despite millions of dollars spent on fieldwork, records searches, and securing the residential school grounds at Kamloops.

How could this be? After all, the Tk’emlúps te Secwépemc First Nation had claimed ground-penetrating radar revealed mass graves at Kamloops. Chief Rosanne Casimir said at a news conference, “It’s a harsh reality and it’s our truth, it’s our history. And it’s something that we’ve always had to fight to prove. To me, it’s always been a horrible, horrible history.”

Asked recently about the $8 million allocated to uncover the truth about the mass graves, the Tk’emlups te Secwepemc First Nation declined to comment.

The whole thing, it turns out, was a rank fiction — a blood libel cooked up to peddle historical grievances, provoke a moral panic, and demonize the Catholic Church and all Anglo Canadians. It worked. And now, three years later, you won’t hear a word from the politicians, media outlets, and liberal activists who perpetrated it.

Understand this dark episode for what it is: a battle in an ongoing cultural war against Western civilization — a war the West is losing.


John Daniel Davidson is a senior editor at The Federalist. His writing has appeared in the Wall Street Journal, the Claremont Review of Books, The New York Post, and elsewhere. He is the author of Pagan America: the Decline of Christianity and the Dark Age to Come. .


TOPICS: Conspiracy; History; Society
KEYWORDS: antipope; canada; christian; christians; church; churches; faithandphilosophy; godsgravesglyphs; helixmakemineadouble; hoax; johnhorgan; justintrudeau; massgraves; romancatholicism
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-62 next last
To: ExpatCanuck
Thank you for your comment. It's very much appreciated. I'm not sure if I've told you this previously, but my mother was born in Picton, Ontario and came to the U.S. as a little girl with her mother and her older brother. They settled in Rochester, NY.

Ancestors of hers had already settled in New York State long before she came here. They fought on both sides during the Revolutionary War. One of her ancestors left NY after serving in a county militia and married the daughter from a Loyalist family. I also had another DNA-connected 5th great-grandfather who came from Germany, and first settled in Dutchess County, N.Y. That's where he married. He moved his family to Pennsylvania. In Pennsylvania he joins Butler's Rangers, a Loyalist provincial military unit in the Revolutionary War, serving a little less than a year. The Rangers had its winter quarters on the West Bank of the Niagara River, and operated mostly in upstate New York and Pennsylvania. He is supposed to have been with the Rangers at Fort Stanwix, N.Y. (Rome, N.Y)., which ironically, is about 8-10 minutes from me. After the war ended he took his family, and settled in Ontario. He's buried in Sillsville (a village named after him), in Lennox and Addington County in Ontario.

My mother's brother served in the U.S. Army during WWII. He wasn't a citizen when he enlisted, and because they didn't have a date of entrance to the U.S., the Army drove him to Niagara Falls, and had him walk back from the Canadian side across the Peace Bridge. He was naturalized during his unit's stop at Fort Sam Houston in Texas, on his way to the west coast to ship overseas. I found his naturalization papers via Ancestry.com. Up until that time, the story had only been a family tale.

My great-uncle from Sophiasberg served in the 38th Battalion (Ottawa) C.E.F. during WWI. He died on Sept. 10, 1918 in France, of wounds he'd received on Sept. 2nd. He's buried in a British Military Cemetery in Wimille, France.

41 posted on 05/10/2024 9:09:01 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 39 | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...

42 posted on 05/10/2024 9:54:28 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: Tell It Right
Did you ever see this guy?

How Beavers Going Extinct in Europe Made The Iroquois Genocide The Huron - King Trout

43 posted on 05/10/2024 10:04:49 PM PDT by gnarledmaw (Hivemind liberals worship leaders, sovereign conservatives select servants.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: dfwgator

LOL!


44 posted on 05/10/2024 10:55:57 PM PDT by jmacusa (Liberals. Too stupid to be idiots.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: SunkenCiv; SeekAndFind

Pardon my ignorance, but is Tk’emlúps te Secwépemc related to Cthulhu?


45 posted on 05/11/2024 3:45:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 42 | View Replies]

To: gnarledmaw
I never saw him. However, I was aware of the Dark Times among the Iroquois tribes.

And in my prior post I threw shade on the indigenous people. But to be fair to not just them, but all groups, it was a tough time to be alive. It's a lot easier to justify taking over each other's land and such when you and your folks are starving. Life during the Little Ice Age meant lower crop yields, less predictable rain patterns, and more deaths from plagues. I'm not saying it's the only reason people in all groups did things like take over each other's land. But it was a major factor.

I like the fact that we live in the Modern Warm Period. It beats living in one of the cooling periods.


46 posted on 05/11/2024 4:10:07 AM PDT by Tell It Right (1st Thessalonians 5:21 -- Put everything to the test, hold fast to that which is true.)
[ Post Reply | Private Reply | To 43 | View Replies]

To: mass55th; SeekAndFind
Mass graves or not, Canada and the U.S. were complicit in tearing native families apart, sending the children off to boarding schools where they were stripped of every aspect of their native culture, forced to have their hair cut, forced to wear white people’s clothes, denied the right to speak their own language, and in some schools, forced to become Catholic.

Isn't that what virtually every people group did? Look at what the Iroquois admit to being the "Dark Times" -- when the tribes fought each other before Columbus. And not just the Iroquois tribes. When they'd fight each other, kill each other, take over each other's land, and force the survivors to become part of the conquering tribe, which meant learning new customs.

Just like the white groups did to each other and other groups. Just like the Muslim groups did to each other and other groups. Just like the Asian groups did to each other and other groups. Just like the black groups did to each other and other groups.

Look at the climate graph in post 46. Know that most of the atrocities we fuss about occurred during the Little Ice Age, when everybody was struggling to survive. It's unfortunately too easy to justify taking over someone else's lands when your crop yields are low and you're starving. And when your rain patterns are less predictable. And when you're experiencing more deaths by plague. Such is life during the centuries-long cooling periods like the Little Ice Age (roughly AD 1300 to mid 1800's), or the Dark Age before that (roughly AD 300 to 900), or the Greek Dark before that (roughly 11th century BC to 3rd century BC, sometimes called the Era of Kings by us Bible geeks).

I'm not saying it's the only reason for those atrocities. But it's very much a factor. That includes the atrocity of my Anglo-Saxon ancestors forced out of modern day Germany during the Dark Age cooling period. (Call it the English version of a Trail of Tears. In fact, the word "Anglo" probably comes from the fact that they lived in Anglia in modern day Germany.) Many believe that the reason the Huns took over land west and south of them was because the Dark Age cooling period forced them to seek land that could grow crops. That displaced the Germanic Goth tribes and forced them to move into what was left of the Roman empire, taking it over by migration. The Huns kept coming and the Germanic Goth tribes had to keep moving, which forced out the Anglos, Saxons, and Jutes, pushing them north into the Denmark area. (Hint: forced north is bad during a cooling period if you're in the northern hemisphere.) They were starving out in that marsh land, so they crossed the channel into Britannia (some say the Huns were moving into the Denmark area and forced the Anglos out).

So the Anglo-Saxons ourselves are a displaced people.

47 posted on 05/11/2024 4:43:20 AM PDT by Tell It Right (1st Thessalonians 5:21 -- Put everything to the test, hold fast to that which is true.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: SeekAndFind

GENOCIDE is everywhere except for when the subject changes to COVID and governments over reaching mandates. Then you are a a loose cannon surviving on marginalized white racism of your ancestors. Pathetic really.

You guys really SUCK.


48 posted on 05/11/2024 7:37:01 AM PDT by Delta 21 (If anyone is treasonous, it is those who call me such.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Tell It Right
"Isn't that what virtually every people group did?"

So just because other groups did it in the past, it's okay that we did it in the late 19th and early 20th century, and should be given a pass for doing it? Being critical of the practice isn't allowed because everybody else in antiquity did it too?

49 posted on 05/11/2024 9:22:08 AM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 47 | View Replies]

To: SeekAndFind
Three years after reports of indigenous mass graves triggered the torching or vandalism of 85-plus churches, no graves have been found.

Mission accomplished!

50 posted on 05/11/2024 10:17:52 AM PDT by E. Pluribus Unum (The worst thing about censorship is █████ ██ ████ ████ ████ █ ███████ ████. FJB.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ruy Dias de Bivar

Esta mierda otra vez? Since Native Americans were making war with and enslaving those from other tribes, stealing land and all that-just like Europeans were doing to each other in Europe, like the Spanish did in Mexico/South America-like the Romans had done to them-there was no altruistic motive like moving these people into the modern world for commerce or a common language-it was just changing the status quo as to who was conquering what tribe/ethic group. It was a brutal era and humans were/are not nice creatures. Natives and Europeans were both out for what they could grab by cheating, rape and pillage, whatever it took, just like they’d been doing for the last 20,000 years or more. Saying it was all for a good cause is/was a bulls*** excuse made up by clergy and other sanctimonious types...


51 posted on 05/11/2024 12:48:08 PM PDT by Texan5 ("You've got to saddle up your boys, you've got to draw a hard line"...)
[ Post Reply | Private Reply | To 21 | View Replies]

To: Texan5

Japan went from a Dark Ages sword swing head choppers into the modern age in TWO Generations beginning in 1853. Yet many of the Indian tribes still long for the Stone age after 400 years of intereaction with Europeans.


52 posted on 05/11/2024 1:05:44 PM PDT by Ruy Dias de Bivar ( Government is not reason, it is not eloquence-it is force!--G. Washington)
[ Post Reply | Private Reply | To 51 | View Replies]

To: SeekAndFind

There is a church cemetery south of Farmington NM with lots of wooden crosses. Most are Navajos who died in the flu epidemic of 1918. In looking at photos of the markers they are wood, with no names on them. In some tribal cultures it is forbidden to mention the name of a dead person.


53 posted on 05/11/2024 1:10:32 PM PDT by Ruy Dias de Bivar ( Government is not reason, it is not eloquence-it is force!--G. Washington)
[ Post Reply | Private Reply | To 1 | View Replies]

To: mass55th

I’m currently reading Thomas Sowell”s “Conquests and Cultures”-in the chapter I’m reading now, he addresses the economic, cultural and other consequences of the early interactions between the Europeans and Native-Iroquois, Mohicans etc in Canada and what is now the Northern border part of the US. The French appear to have been the most pragmatic in their dealings with the Natives in Canada-but that isn’t saying much-Sowell does not gloss over the greed and cruelty on both sides, or the economic advantages gained in trade, theft, raiding, etc.

I do believe we should realize none of our ancestors from anywhere were exactly paragons of virtue, and learn from history. My ancestors were Spanish, with a few Natives thrown in-the Spanish were pretty much the worst of the conquerors of the time with their Inquisition-but the Natives were not innocent victims-they were just outgunned-literally. I also I have not inherited a desire to rack some heretics or cut out some captured enemy’s heart...


54 posted on 05/11/2024 1:24:36 PM PDT by Texan5 ("You've got to saddle up your boys, you've got to draw a hard line"...)
[ Post Reply | Private Reply | To 49 | View Replies]

To: Ruy Dias de Bivar

That is because Japan has/does not have a communist faction in their society spewing revised and unrealistic historical events-I guess they get shouted/smacked down pretty quick over there. In the US and Canada there have been socialists/communists preaching/indoctrinating Native and other kids for more than a century. Place the blame where it belongs-on a society that permits these Marxists to continue preaching and indoctrinating. Stop that and you get rid of the fake history-it starts with getting rid of the current public school system-blow it up and do something that makes sense...


55 posted on 05/11/2024 1:35:41 PM PDT by Texan5 ("You've got to saddle up your boys, you've got to draw a hard line"...)
[ Post Reply | Private Reply | To 52 | View Replies]

To: Ruy Dias de Bivar

Also relevant, I think is the fact that Asians have totally different morals, customs, sense of humor and even think differently than Caucasians or Blacks-and have for 1000’s of years. Their societies are much more regimented and contained.


56 posted on 05/11/2024 1:43:31 PM PDT by Texan5 ("You've got to saddle up your boys, you've got to draw a hard line"...)
[ Post Reply | Private Reply | To 52 | View Replies]

To: mass55th
Being critical of the practice isn't allowed because everybody else in antiquity did it too?

Pretty much.

Not only that it is pretty useless. All involved are dead.

57 posted on 05/11/2024 1:58:49 PM PDT by Harmless Teddy Bear ( Roses are red, Violets are blue, I love being on the government watch list, along with all of you.)
[ Post Reply | Private Reply | To 49 | View Replies]

To: Harmless Teddy Bear
"Not only that it is pretty useless. All involved are dead."

With an attitude like that, it's no wonder nobody knows history anymore.

58 posted on 05/11/2024 2:57:54 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 57 | View Replies]

To: mass55th

Being critical of the practice is allowed. I simply grow tired of the criticism directed solely at on race when it’s obvious that many races did the same.


59 posted on 05/11/2024 3:36:23 PM PDT by Tell It Right (1st Thessalonians 5:21 -- Put everything to the test, hold fast to that which is true.)
[ Post Reply | Private Reply | To 49 | View Replies]

To: Tell It Right
"Being critical of the practice is allowed. I simply grow tired of the criticism directed solely at on race when it’s obvious that many races did the same."

I'm not many races. I'm one race.

60 posted on 05/11/2024 3:58:52 PM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 59 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-62 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson