Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Xenacoelomorpha a new phylum in the animal kingdom
Max-Planck-Gesellschaft ^ | February 15, 2011 | Unknown

Posted on 02/16/2011 8:42:51 AM PST by decimon

Scientists reorganise the animal phylogenetic tree

An international team of scientists including Albert Poustka from the Max Planck Institute for Molecular Genetics in Berlin has discovered that Xenoturbellida and the acoelomorph worms, both simple marine worms, are more closely related to complex organisms like humans and sea urchins than was previously assumed. As a result they have made a major revision to the phylogenetic history of animals. Up to now, the acoelomate worms were viewed as the crucial link between simple animals like sponges and jellyfish and more complex organisms. It has now emerged that these animals did not always have as simple a structure as they do today.

The genus Xenoturbella lives off the coast of Scandinavia, Scotland and Iceland. It shares a simple body structure with the acoelomorph worms: these organisms, which reach a maximum size of just a few millimetres, have no through gut, no gill slits and no body cavity (Greek: coelom = cavity). Many members of both groups live on the ocean floor and feed on organic particles in the sediment. Some species live parasitic, e.g. in the intestines of sea cucumbers.

The animal kingdom is divided into different evolutionary lines. These include, among others, the protostomes (“mouth first”) and deuterostomes (“second mouth”). In the protostomes, the mouth that develops at the beginning of embryonic development becomes the organism’s actual mouth, whereas, in the deuterostomes, it becomes the anus and the mouth develops at a later stage. Three deuterostome phyla were known up to now: the Chordates (e.g. vertebrates), the Echinoderms (sea urchins, starfish, sea cucumbers) and the Hemichordates (e.g. acorn worm). “Our research shows that Xenoturbellida and Acoelomorpha together form the fourth phylum which we have called ‘Xenacoelomorpha’,” explains Albert Poustka from the Planck Institute for Molecular Genetics in Berlin.

(Excerpt) Read more at mpg.de ...


TOPICS: Science
KEYWORDS: albertpoustka; godsgravesglyphs; xenacoelomorpha; xenoturbella; xenoturbellida
Navigation: use the links below to view more comments.
first 1-2021-22 next last

1 posted on 02/16/2011 8:42:52 AM PST by decimon
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; neverdem

Worm outta this ping.


2 posted on 02/16/2011 8:43:31 AM PST by decimon
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

Ib4bf (Bush’s fault).


3 posted on 02/16/2011 8:44:59 AM PST by the invisib1e hand (talk to the hand)
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

Dang it. First they take Pluto away and then they tell us Triceratops isn’t a separate species and now this. I think they’re only doing it to sell textbooks. (Walks off, muttering darkly...)


4 posted on 02/16/2011 9:11:00 AM PST by Billthedrill
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon

These would be the democrats of the worm world.


5 posted on 02/16/2011 9:37:26 AM PST by dangerdoc (see post #6)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Xenalyte

Ping to a similarly named creature.


6 posted on 02/16/2011 9:40:51 AM PST by Disambiguator
[ Post Reply | Private Reply | To 1 | View Replies]

To: Disambiguator; Xenalyte

Don’t forget the “They Named the Phyllum a Cool, Cool Thing” Ping List


7 posted on 02/16/2011 9:45:02 AM PST by Hegewisch Dupa
[ Post Reply | Private Reply | To 6 | View Replies]

To: decimon

An entire phylum for two species? Or am I reading this wrong?


8 posted on 02/16/2011 10:05:25 AM PST by Mr. Bird
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Bird
An entire phylum for two species?

Filling the phylum, one worm at a time.

I guess they figure that more critters will be found to belong to this phylum

9 posted on 02/16/2011 11:00:46 AM PST by decimon
[ Post Reply | Private Reply | To 8 | View Replies]

To: decimon; StayAt HomeMother; Ernest_at_the_Beach; 1010RD; 21twelve; 24Karet; 2ndDivisionVet; ...

· GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach ·
· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
 Antiquity Journal
 & archive
 Archaeologica
 Archaeology
 Archaeology Channel
 BAR
 Bronze Age Forum
 Discover
 Dogpile
 Eurekalert
 Google
 LiveScience
 Mirabilis.ca
 Nat Geographic
 PhysOrg
 Science Daily
 Science News
 Texas AM
 Yahoo
 Excerpt, or Link only?
 


Thanks decimon. King Phillip Came Over From Greater Saxony.

To all -- please ping me to other topics which are appropriate for the GGG list.
 

· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword ·


10 posted on 02/16/2011 4:49:09 PM PST by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | View Replies]

To: decimon
The problem is with the basic laws of mathematics and probability, with which evolution is essentially incompatible. The (proportionally) biggest group of people not buying into evoloserism is mathematicians, and not Christians.

The best illustration of how stupid evolutionism really is involves trying to become some totally new animal with new organs, a new basic plan for existence, and new requirements for integration between both old and new organs.

Take flying birds for example; suppose you aren't one, and you want to become one. You'll need a baker's dozen highly specialized systems, including wings, flight feathers, a system for pivoting flight feathers so that they open on up strokes and close on down strokes, a specialized light bone structure, specialized flow-through lungs and a high efficiency heart, a specialized tail, specialized general balance parameters, a beak (since you won't have hands any more...) etc. etc. etc.

For starters, every one of these things would be antifunctional until the day on which the whole thing came together, so that the chances of evolving any of these things by any process resembling evolution (mutations plus selection) would amount to an infinitessimal, i.e. one divided by some gigantic number.

In probability theory, to compute the probability of two things happening at once, you multiply the probabilities together. That says that the likelihood of all these things ever happening at once (which is what you'd need), best case, is ten or twelve such infinitessimals multiplied together, i.e. a tenth or twelth-order infinitessimal. The whole history of the universe isn't long enough for that to happen once.

All of that was the best case. For the pieces of being a flying bird to evolve piecemeal would be much harder. In real life, natural selection could not plausibly select for hoped-for functionality, which is what would be required in order to evolve flight feathers on something which could not fly apriori. In real life, all you'd ever get would some sort of a random walk around some starting point, rather than the unidircetional march towards a future requirement which evolution requires.

And the real killer, i.e. the thing which simply kills evolutionism dead, is the following consideration: In real life, assuming you were to somehow miraculously evolve the first feature you'd need to become a flying bird, then by the time another 10,000 generations rolled around and you evolved the second such reature, the first, having been disfunctional/antifunctional all the while, would have DE-EVOLVED and either disappeared altogether or become vestigial.

Now, it would be miraculous if, given all the above, some new kind of complex creature with new organs and a new basic plan for life had ever evolved ONCE.

Evolutionism, however (the Theory of Evolution) requires that this has happened countless billions of times, i.e. an essentially infinite number of absolutely zero probability events.

And, if you were starting to think that nothing could possibly be any stupider than believing in evolution despite all of the above (i.e. that the basic stupidity of evolutionism starting from 1980 or thereabouts could not possibly be improved upon), think again. Because there is zero evidence in the fossil record to support any sort of a theory involving macroevolution, and because the original conceptions of evolution are flatly refuted by developments in population genetics since the 1950's, the latest incarnation of this theory, Steve Gould and Niles Eldredge's "Punctuated Equilibrium or punc-eek" attempts to claim that these wholesale violations of probabilistic laws all occurred so suddenly as to never leave evidence in the fossil record, and that they all occurred amongst tiny groups of animals living in "peripheral" areas. That says that some velocirapter who wanted to be a bird got together with fifty of his friends and said:

Guys, we need flight feathers, and wings, and specialized bones, hearts, lungs, and tails, and we need em NOW; not two years from now. Everybody ready, all together now:
OOOOOMMMMMMMMMMMMMmmmmmmmmmmmmmmmmmmmmmmmmmmmmm.....

You could devise a new religion by taking the single stupidest doctrine from each of the existing religions, and it would not be as stupid as THAT.

But it gets even stupider.

Again, the original Darwinian vision of gradualistic evolution is flatly refuted by the fossil record (Darwinian evolution demanded that the vast bulk of ALL fossils be intermediates) and by the findings of population genetics, particularly the Haldane dilemma and the impossible time requirements for spreading genetic changes through any sizeable herd of animals.

Consider what Gould and other punk-eekers are saying. Punc-eek amounts to a claim that all meaningful evolutionary change takes place in peripheral areas, amongst tiny groups of animals which develop some genetic advantage, and then move out and overwhelm, outcompete, and replace the larger herds. They are claiming that this eliminates the need to spread genetic change through any sizeable herd of animals and, at the same time, is why we never find intermediate fossils (since there are never enough of these CHANGELINGS to leave fossil evidence).

Obvious problems with punctuated equilibria include, minimally:

1. It is a pure pseudoscience seeking to explain and actually be proved by a lack of evidence rather than by evidence (all the missing intermediate fossils). Similarly, Cotton Mather claimed that the fact that nobody had ever seen or heard a witch was proof they were there (if you could SEE them, they wouldn't BE witches...) This kind of logic is less inhibiting than the logic they used to teach in American schools.

2. PE amounts to a claim that inbreeding is the most major source of genetic advancement in the world. Apparently Steve Gould never saw Deliverance...

3. PE requires these tiny peripheral groups to conquer vastly larger groups of animals millions if not billions of times, which is like requiring Custer to win at the little Big Horn every day, for millions of years.

4. PE requires an eternal victory of animals specifically adapted to localized and parochial conditions over animals which are globally adapted, which never happens in real life.

5. For any number of reasons, you need a minimal population of any animal to be viable. This is before the tiny group even gets started in overwhelming the vast herds. A number of American species such as the heath hen became non-viable when their numbers were reduced to a few thousand; at that point, any stroke of bad luck at all, a hard winter, a skewed sex ratio in one generation, a disease of some sort, and it's all over. The heath hen was fine as long as it was spread out over the East coast of the U.S. The point at which it got penned into one of these "peripheral" areas which Gould and Eldredge see as the salvation for evolutionism, it was all over.

The sort of things noted in items 3 and 5 are generally referred to as the "gambler's problem", in this case, the problem facing the tiny group of "peripheral" animals being similar to that facing a gambler trying to beat the house in blackjack or roulette; the house could lose many hands of cards or rolls of the dice without flinching, and the globally-adapted species spread out over a continent could withstand just about anything short of a continental-scale catastrophe without going extinct, while two or three bad rolls of the dice will bankrupt the gambler, and any combination of two or three strokes of bad luck will wipe out the "peripheral" species. Gould's basic method of handling this problem is to ignore it.

And there's one other thing which should be obvious to anybody attempting to read through Gould and Eldridge's BS:

The don't even bother to try to provide a mechanism or technical explaination of any sort for this "punk-eek"

They are claiming that at certain times, amongst tiny groups of animals living in peripheral areas, a "speciation event(TM)" happens, and THEN the rest of it takes place. In other words, they are saying:

ASSUMING that Abracadabra-Shazaam(TM) happens, then the rest of the business proceeds as we have described in our scholarly discourse above!

Again, Gould and Eldridge require that the Abracadabra-Shazaam(TM) happen not just once, but countless billions of times, i.e. at least once for every kind of complex creature which has ever walked the Earth. They do not specify whether this amounts to the same Abracadabra-Shazaam each time, or a different kind of Abracadabra-Shazaam for each creature.

11 posted on 02/16/2011 4:56:58 PM PST by wendy1946
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv
Phyllum? It pert near killed 'im!
12 posted on 02/16/2011 6:08:54 PM PST by Ken H
[ Post Reply | Private Reply | To 10 | View Replies]

To: decimon

New invertebrate phylum in the Kingdom! There will be toga parties!


13 posted on 02/16/2011 8:59:47 PM PST by Domestic Church (AMDG)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wendy1946
The best illustration of how stupid evolutionism really is

I stopped reading right there, and not for the reasons you would like to assume.
14 posted on 02/16/2011 10:04:32 PM PST by BJClinton ("Worse" technically is "change".)
[ Post Reply | Private Reply | To 11 | View Replies]

To: wendy1946; SunkenCiv
In probability theory, to compute the probability of two things happening at once, you multiply the probabilities together.

That is only correct if the two events are independent, otherwise it is wrong. As an application you might check a textbook in Chemistry and read about chemical synthesis and use different conditions.
15 posted on 02/17/2011 12:17:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Billthedrill

It boils down to are you are splitter or a lumper. You must make the decision.


16 posted on 02/17/2011 4:31:57 AM PST by bert (K.E. N.P. N.C. D.E. +12 ....( History is a process, not an event ))
[ Post Reply | Private Reply | To 4 | View Replies]

To: wendy1946
wendy1946: "For starters, every one of these things would be antifunctional until the day on which the whole thing came together.."

There are innumerable examples amongst living species, the fossil record, DNA analysis and even embryo development of "intermediate" stages, showing how evolution can proceed one-step-at-a-time, over many millions of generations, to eventually produce the diversities we see today.

Wendy1946: "In real life, all you'd ever get would some sort of a random walk around some starting point, rather than the unidircetional march towards a future requirement which evolution requires. "

Every tiny step on the path, for example, from reptile to bird stands alone as the result of genetic mutation and natural selection.
Sure, some have claimed that a particular evolutionary step is impossible, but no one has ever proved that scientifically.

Wendy1946: "...the first, having been disfunctional/antifunctional all the while, would have DE-EVOLVED and either disappeared altogether or become vestigial."

In DNA terms, vestigial features are never fully lost.
If over time, some "vestigial" function were to begin increasing survivability in a species, then that function would soon be selected for, along with any enhancements which further increase survivability.
In other words, in time it would no longer be "vestigial."

Wendy1946: "Evolutionism, however (the Theory of Evolution) requires that this has happened countless billions of times, i.e. an essentially infinite number of absolutely zero probability events."

Note the sequence and time periods:

  1. The first hints of material produced by life are found in rocks dated to circa 4 billion years ago.

  2. In strata dated three and a half billion years later, during the Cambrian Explosion, we begin to see all the basic life forms -- biological Domains (i.e., Eukaryota 2.1 billion years ago), Kingdoms (i.e., Animalia 600 million years) and Phylums (i.e., Cordata 500 million years).

  3. by 200 million years ago we see most biological classes (i.e., Mammals)

  4. by 100 million years ago the familiar orders (i.e., Primates, monkeys),

  5. by 30 million years ago many current families (i.e., Hominids, apes)
  6. by three million years ago modern genuses (i.e., Homo, pre-human)
  7. by 500,000 years ago species (i.e., Homo sapiens, Neandertals)
  8. and by 200,000 years ago modern subspecies (i.e., Homo sapien sapiens, humans).

A key point to notice here is that major changes take very, very long times.
Relatively minor changes happen more quickly.

Wendy1946: "But it gets even stupider."

Referring to your own arguments, presumably.
A good place for me to stop.

17 posted on 02/17/2011 5:35:40 AM PST by BroJoeK (a little historical perspective....)
[ Post Reply | Private Reply | To 11 | View Replies]

To: BJClinton
I stopped reading right there

So what??

18 posted on 02/17/2011 6:07:23 AM PST by wendy1946
[ Post Reply | Private Reply | To 14 | View Replies]

To: BroJoeK
There are innumerable examples amongst living species, the fossil record, DNA analysis and even embryo development of "intermediate" stages, showing how evolution can proceed one-step-at-a-time, over many millions of generations, to eventually produce the diversities we see today.

When a theory reaches the point of being defensible only by lying, you should drop it.

19 posted on 02/17/2011 6:09:42 AM PST by wendy1946
[ Post Reply | Private Reply | To 17 | View Replies]

To: wendy1946
wendy1946: "When a theory reaches the point of being defensible only by lying, you should drop it."

And yet you continue to argue against the truth.

20 posted on 02/17/2011 1:12:06 PM PST by BroJoeK (a little historical perspective....)
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-22 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson