Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Volcanic origin of proteins?
The Scientist ^ | 21st March 2011 | Hannah Waters

Posted on 03/23/2011 1:51:59 AM PDT by AdmSmith

The reanalysis of a 1958 experiment suggests that volcanic eruptions may have spawned the amino acids that contributed to the rise of life on earth

Scientific debates don't get much hotter than the one surrounding the origin of organic molecules at the dawn of life on Earth. New findings, based on a reanalysis of a 50-year-old experiment, suggests that ancient volcanic activity was the source of the very first amino acids.

In the 1950s, Stanley Miller and Harold Urey of the University of Chicago performed a series of "spark discharge" experiments, in which the researchers applied electrical sparks-- meant to simulate lightning -- to a mixture of gases in steam-filled flasks. As the heat inside the flasks rose and the sparks flew, solids were produced and were captured in vials that could be stored for later analysis. Amino acids were formed in these reactions and they provided support for Miller's hypothesis that organic molecules could be formed from inorganic gases.

(Excerpt) Read more at the-scientist.com ...


TOPICS: Culture/Society; Extended News
KEYWORDS: catastrophism; chemistry; godsgravesglyphs; life; millerurey; panspermia; xplanets
Navigation: use the links below to view more comments.
first 1-5051-63 next last
Positive impacts of volcanoes
1 posted on 03/23/2011 1:52:07 AM PDT by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; decimon; neverdem; nuconvert

Original article http://www.pnas.org/content/early/2011/03/14/1019191108.abstract


2 posted on 03/23/2011 1:53:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Holy Cow! L. Ron was right!?


3 posted on 03/23/2011 1:59:35 AM PDT by DeltaZulu
[ Post Reply | Private Reply | To 1 | View Replies]

To: DeltaZulu

No, in his SF books it was 75 million years ago that Xenu landed. LOL!


4 posted on 03/23/2011 2:03:39 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
......In the 1950s, Stanley Miller and Harold Urey of the University of Chicago performed a series of "spark discharge" experiments, in which the researchers applied electrical sparks-- meant to simulate lightning -- to a mixture of gases in steam-filled flasks...


5 posted on 03/23/2011 2:26:01 AM PDT by Cincinatus' Wife
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

One spark-discharge experiment using radioactivity ran all night and in the morning the vessel was found broken open. Little footprints of black goo led to the window and a note was left........ What did the note say?
“Gone fission!”


6 posted on 03/23/2011 3:46:47 AM PDT by count-your-change (You don't have be brilliant, not being stupid is enough.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DeltaZulu; AdmSmith
“It all began 75 million years ago with a galactic federation of planets ruled by the evil Lord Xenu, Fearing overcrowding, Xenu rounded up countless aliens from all those planets and had those aliens frozen. The frozen alien bodies were loaded onto Xenu's galactic cruisers, which looked like DC-8s, except with rocket engines. They were sent to earth and dumped into the volcanoes of Hawaii and other volcanoes. They were no longer frozen. They were dead. "The souls of the aliens floated toward the sky," the president continued, explaining that Xenu had built giant "soul catchers" to collect them all and unload them into a brainwashing facility he had built on earth. "The souls were forced to watch days of brainwashing material that tricked them into believing a false reality," the president revealed. "Xenu then released the alien souls that roamed the earth aimlessly in a fog of confusion. At the dawn of man the aliens found bodies they could grab onto. They attached themselves to all mankind, which still to this day causes all our fears, confusions and problems."
7 posted on 03/23/2011 4:01:49 AM PDT by Vaquero ("an armed society is a polite society" Robert A. Heinlein)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
Since Miller and Urey's experiment was utterly discredited as an origin-of-life scenario, the scientists have now backed off and want to use it as a scenario for the origin of proteins/amino acids. Fine, but it does not solve the REAL problem in origin of life: Where did the information contained in DNA and RNA come from?
8 posted on 03/23/2011 4:56:38 AM PDT by backwoods-engineer (Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: backwoods-engineer
Fine, but it does not solve the REAL problem in origin of life: Where did the information contained in DNA and RNA come from?

It's pretty much the same all over. Look at metallurgy. Sure, they've figured out some interesting stuff, but it basically just worthless crap, because it doesn't tell us where the metal came from.

9 posted on 03/23/2011 5:04:37 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 8 | View Replies]

To: tacticalogic

Just tell me where the gold comes from and I’ll go get as much of it as I can.


10 posted on 03/23/2011 5:54:08 AM PDT by muawiyah (Make America Safe For Amercans)
[ Post Reply | Private Reply | To 9 | View Replies]

To: tacticalogic
Uhhh... that's kind of different. Metal is a material created in the hearts of stars of various kinds. That can be observed directly, by spectroscopy.

Information is created by a mind. A metallic crystalline structure has symmetry and regularity, but that isn't information.

11 posted on 03/23/2011 6:22:35 AM PDT by backwoods-engineer (Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
[ Post Reply | Private Reply | To 9 | View Replies]

To: muawiyah
Just tell me where the gold comes from and I’ll go get as much of it as I can.

Sorry, can't help. I could say "It comes from volcanic eruptions and vents", but that doesn't answer the question, because it doesn't tell you where it came from before that.

12 posted on 03/23/2011 6:38:28 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 10 | View Replies]

To: backwoods-engineer
Information is created by a mind.

That's true. Without a mind to organize and analyze it, it's just data.

13 posted on 03/23/2011 6:50:00 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 11 | View Replies]

To: muawiyah

Type II supernovae of between 40 and 80 solar masses. It happens during the collapse. Don’t get burned trying to get it!


14 posted on 03/23/2011 6:59:56 AM PDT by backwoods-engineer (Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
[ Post Reply | Private Reply | To 10 | View Replies]

To: muawiyah

15 posted on 03/23/2011 7:16:39 AM PDT by epithermal
[ Post Reply | Private Reply | To 10 | View Replies]

To: AdmSmith

“Well, Bobby, another one of those big questions for Mr. Science. ‘Can volcanoes produce life?’ Hmmm. You know the Mr. Science motto, ‘Doing Is Knowing!’ We have here a bowl of boiling cheese-dip to simulate the lava in a volcano. Here is our bottle of hydrogen and a sparkler to simulate lightning. Just a second. The court order requires that the fire department be notified whenever I conduct an experiment. Have we done that Director Lisa? OK! Here we go. We turn on the hydrogen...and put the lit sparkler over the cheese. HOTCHEESE!!!HOTCHEESE!!!HOTCHEESE!!! Thanks Cameraman Steve. That cheese-lava can really scald you. Once again, science triumphs over superstition! ‘Can volcanoes produce life?’ The answer is no, volcanoes can produce third-degree burns. Mr. Science has been receiving letters requesting him at birthday parties. The District Attorney has threatened to throw Mr. Science in Jail ‘until the end of time’ if he works at any more birthday parties. I will be at the Harrison Avenue Mall this Saturday from noon to four demonstrating volcanoes. Free nachos, too!”


16 posted on 03/23/2011 8:03:26 AM PDT by blueunicorn6 ("A crack shot and a good dancer")
[ Post Reply | Private Reply | To 1 | View Replies]

To: 75thOVI; agrace; aimhigh; Alice in Wonderland; AndrewC; aragorn; aristotleman; Avoiding_Sulla; ...

Thanks AdmSmith.
 
Catastrophism
 
· join · view topics · view or post blog · bookmark · post new topic · subscribe ·
 

17 posted on 03/23/2011 5:06:15 PM PDT by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | View Replies]

To: KevinDavis; annie laurie; garbageseeker; Knitting A Conundrum; Viking2002; Ernest_at_the_Beach; ...

Thanks AdmSmith. Panspermia ping.
 
X-Planets
· join · view topics · view or post blog · bookmark · post new topic · subscribe ·
Google news searches: exoplanet · exosolar · extrasolar ·

18 posted on 03/23/2011 5:06:25 PM PDT by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | View Replies]

To: AdmSmith; StayAt HomeMother; Ernest_at_the_Beach; 1010RD; 21twelve; 24Karet; 2ndDivisionVet; ...

· GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach ·
· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
 Antiquity Journal
 & archive
 Archaeologica
 Archaeology
 Archaeology Channel
 BAR
 Bronze Age Forum
 Discover
 Dogpile
 Eurekalert
 Google
 LiveScience
 Mirabilis.ca
 Nat Geographic
 PhysOrg
 Science Daily
 Science News
 Texas AM
 Yahoo
 Excerpt, or Link only?
 


Thanks AdmSmith.

To all -- please ping me to other topics which are appropriate for the GGG list.
 

· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword ·


19 posted on 03/23/2011 5:06:25 PM PDT by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | View Replies]

To: AdmSmith

This is as likely as a Boeing 757 being left behind after a tornado sweeps through a junk yard. And this theory fails to account for the information required to assemble amino acids into proteins. And, it fails to account for teleonomy and autopoiesis. I will invoke Polanyi’s Impossibility here!


20 posted on 03/23/2011 7:06:25 PM PDT by LiteKeeper ("Psalm 109:8")
[ Post Reply | Private Reply | To 1 | View Replies]

To: tacticalogic
Without a mind to organize and analyze it, it's just data.

No, it doesn't exist, because datum(data) is(are) an() abstraction(s). Where does a kilogram come from? Or the color red? Or 98.6 degrees fahrenheit?

21 posted on 03/24/2011 4:01:01 AM PDT by AndrewC
[ Post Reply | Private Reply | To 13 | View Replies]

To: AndrewC
No, it doesn't exist, because datum(data) is(are) an() abstraction(s). Where does a kilogram come from? Or the color red? Or 98.6 degrees fahrenheit?

Then "information" is no less an abstraction. KG, red, and degrees farenheight are labels used to quantify observations. The mass of an object, the wavelength of light it reflects, or it's thermal radiation are still there, whether they were observed, measured, and labeled or not.

22 posted on 03/24/2011 4:13:02 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 21 | View Replies]

To: tacticalogic
Then "information" is no less an abstraction.

I think that is what is being asserted. I also think that quantum theorists will argue with your last statement, "meow".

23 posted on 03/24/2011 4:37:28 AM PDT by AndrewC
[ Post Reply | Private Reply | To 22 | View Replies]

To: AndrewC

Quantum theory is a different context, and forcing those terms into this context is sophistry. Information without data is dogma.


24 posted on 03/24/2011 5:34:29 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 23 | View Replies]

To: backwoods-engineer

Information Science has proven that any information must come from a source with more information.


25 posted on 03/24/2011 5:37:35 AM PDT by MrB (The difference between a Humanist and a Satanist - the latter knows whom he's working for)
[ Post Reply | Private Reply | To 8 | View Replies]

To: LiteKeeper
"Yeah, but given enough time..." :)
26 posted on 03/24/2011 5:43:04 AM PDT by MrB (The difference between a Humanist and a Satanist - the latter knows whom he's working for)
[ Post Reply | Private Reply | To 20 | View Replies]

To: tacticalogic
Quantum theory is a different context, and forcing those terms into this context is sophistry. Information without data is dogma.

Well, now is your opportunity to back up your claims. I especially enjoy the irony of your last statement. I repeat my last posting in different words, in that, information and data are being established as requiring a mind.(IE they are abstractions)

27 posted on 03/24/2011 5:47:16 AM PDT by AndrewC
[ Post Reply | Private Reply | To 24 | View Replies]

To: AndrewC
Well, now is your opportunity to back up your claims. I especially enjoy the irony of your last statement. I repeat my last posting in different words, in that, information and data are being established as requiring a mind.(IE they are abstractions)

The abastractions are in the mind of the observer, so "information" is not an intrinsic property.

28 posted on 03/24/2011 5:53:52 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 27 | View Replies]

To: tacticalogic
The abastractions are in the mind of the observer, so "information" is not an intrinsic property.

Voila! A mind is required.

29 posted on 03/24/2011 2:03:17 PM PDT by AndrewC
[ Post Reply | Private Reply | To 28 | View Replies]

To: AndrewC
Voila! A mind is required.

I never claimed otherwise. It's axiomatic that a mind is required. The mendacity is in the implication that it must have been some "mind" external to the observer.

30 posted on 03/24/2011 2:07:45 PM PDT by tacticalogic
[ Post Reply | Private Reply | To 29 | View Replies]

To: tacticalogic
The mendacity is in the implication that it must have been some "mind" external to the observer.

Well here again is your chance to prove that statement(I have never observed my great-grandfather). And you leave out that data are also abstractions.

31 posted on 03/24/2011 2:33:51 PM PDT by AndrewC
[ Post Reply | Private Reply | To 30 | View Replies]

To: AndrewC
Well here again is your chance to prove that statement

Very well. I'll offer as proof the observation that when you say "a mind is required" for there to be information, you will NEVER volunteer that the "mind" in question is the mind of the person who looked at it and decided it was "information".

32 posted on 03/24/2011 2:45:51 PM PDT by tacticalogic
[ Post Reply | Private Reply | To 31 | View Replies]

To: tacticalogic
Very well. I'll offer as proof the observation that when you say "a mind is required" for there to be information, you will NEVER volunteer that the "mind" in question is the mind of the person who looked at it and decided it was "information".

What sort of proof is that? I repeat I have never observed my great-grandfather.

Plus your "definition" of information is pretty useless. Its seems a conclusion using your premise is that outside of a specific mind being discussed there is no information. And it would seem that this is not information


33 posted on 03/24/2011 3:20:49 PM PDT by AndrewC
[ Post Reply | Private Reply | To 32 | View Replies]

To: AndrewC

There is no information there unless there is a mind that can see it and make sense of it.

Similarly, there is no “information” in DNA absent a ribosome and tRNAs that can “decode” and “translate” an otherwise meaningless sequence of nucleic acids into a functional sequence of amino acids.


34 posted on 03/24/2011 3:26:21 PM PDT by allmendream (Tea Party did not send the GOP to D.C. to negotiate the terms of our surrender to socialism.)
[ Post Reply | Private Reply | To 33 | View Replies]

To: AndrewC
Plus your "definition" of information is pretty useless. Its seems a conclusion using your premise is that outside of a specific mind being discussed there is no information. And it would seem that this is not information

The only definition of "information" in play here is that it is an abstraction, which you've already agreed to. It is a mental construct, and it is "information" within any mind that can comprehend it and use it to make that construction. Before that happened, it was not "information".

35 posted on 03/24/2011 3:42:26 PM PDT by tacticalogic
[ Post Reply | Private Reply | To 33 | View Replies]

To: AndrewC
I repeat I have never observed my great-grandfather.

What is the significance of you never having observed your great-grandfather?

36 posted on 03/24/2011 3:44:10 PM PDT by tacticalogic
[ Post Reply | Private Reply | To 33 | View Replies]

To: tacticalogic
According to professor Werner Gitt, Professor Emeritus of Information Technology, there are five properties necessary to have information


37 posted on 03/24/2011 6:59:11 PM PDT by LiteKeeper ("Psalm 109:8")
[ Post Reply | Private Reply | To 35 | View Replies]

To: tacticalogic
According to professor Werner Gitt, Professor Emeritus of Information Technology, there are five properties necessary to have information

Here is the important part: only a mind can produce those properties. They can not be accounted for by chemistry, nor physics...there is no straight line path from matter to information. This is Polanyi's Impossibility.

38 posted on 03/24/2011 7:01:30 PM PDT by LiteKeeper ("Psalm 109:8")
[ Post Reply | Private Reply | To 35 | View Replies]

To: LiteKeeper
Here is the important part: only a mind can produce those properties.

We've been discussing precisely that. Once it is understood that information is an abstraction, it is axiomatic that only a mind can produce it.

The conversation started with an assertion that the science of studying things like DNA is different than a science like metallurgy, because the molecular structure of DNA "contains information" while the the molecular structure of something like a metal alloy does not.

What say you?

39 posted on 03/24/2011 7:22:03 PM PDT by tacticalogic
[ Post Reply | Private Reply | To 38 | View Replies]

To: tacticalogic
DNA is like a DVD, or a page in a book. It is the medium upon which information is stored, but it is not the information.

Here is the mystery: The sequence of nucleotides (each triplet being called a codon) is specific to a protein. So one codon equates to one of twenty amino acids...and just that amino acid. There are actually 64 possible combinations. Where is the "codon lexicon"????? Where is the association between a specific codon and a specific amino acid recorded? What table exists to clarify which is which?

There is only one possible explanation for this "codon lexicon" - intelligence; a mind. Meaning is an abstraction that cannot be a property of the "stuff" which the nucleotides are made of...it is not the product of chemical activity, nor of the physics...it can only come from a mind.

40 posted on 03/24/2011 8:38:51 PM PDT by LiteKeeper ("Psalm 109:8")
[ Post Reply | Private Reply | To 39 | View Replies]

To: allmendream
Similarly, there is no “information” in DNA absent a ribosome and tRNAs that can “decode” and “translate” an otherwise meaningless sequence of nucleic acids into a functional sequence of amino acids.

So you claim that the plate on voyager presently lost the information on it. Strange view.

41 posted on 03/25/2011 1:20:10 AM PDT by AndrewC
[ Post Reply | Private Reply | To 34 | View Replies]

To: tacticalogic
It is a mental construct, and it is "information" within any mind that can comprehend it and use it to make that construction. Before that happened, it was not "information".

So you too are saying that the plate on voyager presently contains no information?

42 posted on 03/25/2011 1:25:04 AM PDT by AndrewC
[ Post Reply | Private Reply | To 35 | View Replies]

To: tacticalogic
What is the significance of you never having observed your great-grandfather?

It has to do with your claim "The mendacity is in the implication that it must have been some "mind" external to the observer."

43 posted on 03/25/2011 1:33:07 AM PDT by AndrewC
[ Post Reply | Private Reply | To 36 | View Replies]

To: AndrewC
So you too are saying that the plate on voyager presently contains no information?

And you are saying the plate has a mind.

44 posted on 03/25/2011 3:20:31 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 42 | View Replies]

To: AndrewC
It has to do with your claim "The mendacity is in the implication that it must have been some "mind" external to the observer."

In that case, adding more carbon will make the modulus turn purple.

45 posted on 03/25/2011 3:29:21 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 43 | View Replies]

To: LiteKeeper
There is only one possible explanation for this "codon lexicon" - intelligence; a mind. Meaning is an abstraction that cannot be a property of the "stuff" which the nucleotides are made of...it is not the product of chemical activity, nor of the physics...it can only come from a mind.

How do we know it cannot be a property of the "stuff"?

46 posted on 03/25/2011 3:34:09 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 40 | View Replies]

To: tacticalogic
And you are saying the plate has a mind.

No, but it certainly contains information in spite of your convoluted definitions.

47 posted on 03/25/2011 3:39:42 AM PDT by AndrewC
[ Post Reply | Private Reply | To 44 | View Replies]

To: AndrewC
No, but it certainly contains information in spite of your convoluted definitions.

What's the matter. Don't you like having words put in you mouth? Don't want, don't start.

48 posted on 03/25/2011 3:41:16 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 47 | View Replies]

To: tacticalogic
In that case, adding more carbon will make the modulus turn purple

JFilko!

49 posted on 03/25/2011 3:41:16 AM PDT by AndrewC
[ Post Reply | Private Reply | To 45 | View Replies]

To: AndrewC
JFilko!

Athyroio!

50 posted on 03/25/2011 3:45:11 AM PDT by tacticalogic
[ Post Reply | Private Reply | To 49 | View Replies]


Navigation: use the links below to view more comments.
first 1-5051-63 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson