Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Antibiotics that target mitochondria effectively eradicate cancer stem cells...
Impact Journals ^ | January 22, 2015 | Various

Posted on 2/9/2015, 12:37:54 AM by 2ndDivisionVet

Abstract

Here, we propose a new strategy for the treatment of early cancerous lesions and advanced metastatic disease, via the selective targeting of cancer stem cells (CSCs), a.k.a., tumor-initiating cells (TICs). We searched for a global phenotypic characteristic that was highly conserved among cancer stem cells, across multiple tumor types, to provide a mutation-independent approach to cancer therapy. This would allow us to target cancer stem cells, effectively treating cancer as a single disease of “stemness”, independently of the tumor tissue type. Using this approach, we identified a conserved phenotypic weak point – a strict dependence on mitochondrial biogenesis for the clonal expansion and survival of cancer stem cells. Interestingly, several classes of FDA-approved antibiotics inhibit mitochondrial biogenesis as a known “side-effect”, which could be harnessed instead as a “therapeutic effect”. Based on this analysis, we now show that 4-to-5 different classes of FDA-approved drugs can be used to eradicate cancer stem cells, in 12 different cancer cell lines, across 8 different tumor types (breast, DCIS, ovarian, prostate, lung, pancreatic, melanoma, and glioblastoma (brain)). These five classes of mitochondrially-targeted antibiotics include: the erythromycins, the tetracyclines, the glycylcyclines, an anti-parasitic drug, and chloramphenicol. Functional data are presented for one antibiotic in each drug class: azithromycin, doxycycline, tigecycline, pyrvinium pamoate, as well as chloramphenicol, as proof-of-concept. Importantly, many of these drugs are non-toxic for normal cells, likely reducing the side effects of anti-cancer therapy....

(Excerpt) Read more at impactjournals.com ...


TOPICS: Business/Economy; Health/Medicine; Science; Society
KEYWORDS: antibiotics; azithromycin; braincancer; breakthrough; breastcancer; cancer; cancercure; cancerresearch; chloramphenicol; copd; cscs; dcis; doxycycline; dsj02; erythromycin; glioblastoma; glycylcycline; lungcancer; melanoma; mitochondria; ovariancancer; pancreaticcancer; prostatecancer; pyrviniumpamoate; science; stemcells; tetracycline; tics; tigecycline
Navigation: use the links below to view more comments.
first 1-2021-26 next last
Full title: Antibiotics that target mitochondria effectively eradicate cancer stem cells, across multiple tumor types: Treating cancer like an infectious disease
1 posted on 2/9/2015, 12:37:54 AM by 2ndDivisionVet
[ Post Reply | Private Reply | View Replies]

To: 2ndDivisionVet

Thanks for posting this.


2 posted on 2/9/2015, 12:42:30 AM by ifinnegan
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

Wow, that would be something! Along with targeted immunotherapy, the landscape is changing. Good news.


3 posted on 2/9/2015, 12:43:50 AM by SueRae (It isn't over. In God We Trust.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet

Really interesting. Glad you posted this.


4 posted on 2/9/2015, 12:44:48 AM by dforest
[ Post Reply | Private Reply | To 1 | View Replies]

To: SueRae

Also, they are 3D printing real human livers as we speak and are working on hearts, kidneys and many other organs. There will be no rejection issues since they’ll be using your cells.


5 posted on 2/9/2015, 12:51:13 AM by 2ndDivisionVet (The question isn't who is going to let me; it's who is going to stop me.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: 2ndDivisionVet

I read that a couple of parents doing cancer research asked their 8 y.o. daughter what they should check out and the daughter suggested antibiotics.


6 posted on 2/9/2015, 12:58:45 AM by Blood of Tyrants (True followers of Christ emulate Christ. True followers of Mohammed emulate Mohammed.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AngieGal

ping


7 posted on 2/9/2015, 1:17:22 AM by PetroniusMaximus
[ Post Reply | Private Reply | To 1 | View Replies]

To: Blood of Tyrants

as I understand it cancer does not grow where there is not a fungal presence.

kill the fungus starve the cancer


8 posted on 2/9/2015, 1:30:21 AM by MeshugeMikey ("Never, Never, Never, Give Up," Winston Churchill ><>)
[ Post Reply | Private Reply | To 6 | View Replies]

To: MeshugeMikey

a fungal infection may or may not be a cause.

the negative body conditions that exist promote both cancer and fungus to grow. so they may or may not be causally related. fungus likes acidic conditions and a sugary/hi carb diet. so does cancer.


9 posted on 2/9/2015, 1:47:45 AM by Secret Agent Man (Gone Galt; Not averse to Going Bronson.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: 2ndDivisionVet

Friend of mine has an uncle in a trial in Boston.

Uncle had advanced COPD and otherwise healthy. 60-70 year old.

Stem cells were removed and instilled back in his lungs. After 5 tears on o2 he can breathe normally.

this is the future folks.


10 posted on 2/9/2015, 1:50:23 AM by Chickensoup (Leftist totalitarian fascism is on the move.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Secret Agent Man

the possibilities boggle the mind.


11 posted on 2/9/2015, 1:52:09 AM by MeshugeMikey ("Never, Never, Never, Give Up," Winston Churchill ><>)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Shimmer1

ping.


12 posted on 2/9/2015, 2:16:32 AM by null and void (Our goal is language that is gender-, ethnic- and age-neutral, while celebrating our diversity!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: 2ndDivisionVet
Also, they are 3D printing real human livers as we speak and are working on hearts, kidneys and many other organs. There will be no rejection issues since they’ll be using your cells.

In some ways the world is getting better. In many other ways it is getting worse. I notice you spend quite a lot of time making sure we all know about some of the bad things going on in the world.

It's good to see you post some good news for a change. I believe I know why you post so much of the bad, and it's a good thing that you do, and i'm glad you do it, even though many of your articles leave me disgusted.

But yes, we seem to be reaching an era where pretty much anything will be curable.

13 posted on 2/9/2015, 2:48:25 AM by DiogenesLamp
[ Post Reply | Private Reply | To 5 | View Replies]

To: MeshugeMikey
as I understand it cancer does not grow where there is not a fungal presence.

kill the fungus starve the cancer

I have never heard that. I have heard quite a lot of connections between cancer and viruses, but not fungus.

14 posted on 2/9/2015, 2:49:38 AM by DiogenesLamp
[ Post Reply | Private Reply | To 8 | View Replies]

To: 2ndDivisionVet
Thanks for the post. My Wife found it interesting and pointed out the different classes of antibiotics used now for cancer treatment.

Anti-tumor antibiotics

Anthracyclines


Anthracyclines are anti-tumor antibiotics that interfere with enzymes involved in DNA replication. These drugs work in all phases of the cell cycle. They are widely used for a variety of cancers. A major consideration when giving these drugs is that they can permanently damage the heart if given in high doses. For this reason, lifetime dose limits are often placed on these drugs.

Examples of anthracyclines include:
Daunorubicin
Doxorubicin (Adriamycin®)
Epirubicin
Idarubicin

Other anti-tumor antibiotics

Anti-tumor antibiotics that are not anthracyclines include:
Actinomycin-D
Bleomycin
Mitomycin-C

Mitoxantrone is an anti-tumor antibiotic that is similar to doxorubicin in many ways, including the potential for damaging the heart. This drug also acts as a topoisomerase II inhibitor (see below), and can lead to treatment-related leukemia. Mitoxantrone is used to treat prostate cancer, breast cancer, lymphoma, and leukemia.


She wondered if these treatments were the genesis of the researcher's thinking.
15 posted on 2/9/2015, 3:01:09 AM by PA Engineer (Liberate America from the Occupation Media.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Thanks 2ndDivisionVet.


16 posted on 2/9/2015, 3:54:00 AM by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary men)
[ Post Reply | Private Reply | View Replies]

To: 2ndDivisionVet

Includes pancreatic cancer - this would be a real breakthrough.....


17 posted on 2/9/2015, 4:53:48 AM by Intolerant in NJ
[ Post Reply | Private Reply | To 1 | View Replies]

To: Chickensoup

Chickensoup, the stem cell treatment success sounds fascinating! I did not know anyone was getting this treatment in Boston. Do you have any other information, like clinic name or doctor? I have a young brother with COPD that is now being considered for a lung transplant. The stem cell treatment sounds like a much better alternative, or at least something to try before undergoing a transplant! So, if you have any info that could be shared, I would appreciate your help!


18 posted on 2/9/2015, 5:07:44 AM by Sunshine Again
[ Post Reply | Private Reply | To 10 | View Replies]

To: 2ndDivisionVet

Interesting, if you combine this with the use of http://en.wikipedia.org/wiki/CRISPR (more on CRISP is in this very good article https://www.quantamagazine.org/20150206-crispr-dna-editor-bacteria/ and this 4 min youtube video https://www.youtube.com/watch?v=2pp17E4E-O8 )


19 posted on 2/9/2015, 8:17:06 AM by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sunshine Again

I will email my friend and get the name of the hospital and study.


20 posted on 2/9/2015, 1:57:10 PM by Chickensoup (Leftist totalitarian fascism is on the move.)
[ Post Reply | Private Reply | To 18 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-26 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson