Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

New rooms discovered in Sahura's pyramid
University of Wurzburg ^ | September 27, 2023 | Phys dot org

Posted on 09/30/2023 8:39:06 AM PDT by SunkenCiv

...The exploration has unearthed a number of storage rooms that had not been documented before. This discovery sheds new light on the architecture of the pyramid of Sahura, the second king of the Fifth Dynasty (2400 BC) and the first king to be buried at Abusir.

The conservation and restoration project inside Sahura's pyramid, initiated in 2019 and supported by the Antiquities Endowment Fund (AEF) of the American Research Center in Egypt (ARCE), aimed to safeguard the substructure of Sahura's pyramid. The team's efforts focused on cleaning the interior rooms, stabilizing the pyramid from inside, and preventing further collapse. In the process, the team succeeded in securing the pyramid's burial chambers, which had previously been inaccessible.

During the restoration work, the team discovered the original dimensions and was able to uncover the floor plan of the antechamber, which had deteriorated over time. Consequently, the destroyed walls were replaced with new retaining walls. The eastern wall of the antechamber was badly damaged, and only the northeast corner and about 30 centimeters of the eastern wall were still visible.

Traces of a low passageway that John Perring had already noticed during an excavation in 1836 continued to be excavated. Perring had mentioned that this passage had been full of debris and rubbish and had been impassable due to decay. The British Egyptologist suspected that it might have led to storage rooms. However, during further exploration of the pyramid by Ludwig Borchardt in 1907, these assumptions were called into question—other experts joined his opinion.

All the more surprising was the find of the Egyptian-German team, which actually discovered traces of a passage. Thereby proving that the observations made during Perring's exploration were correct.

(Excerpt) Read more at phys.org ...


TOPICS: History; Science; Travel
KEYWORDS: 5thdynasty; abusir; egypt; godsgravesglyphs; oldkingdom; pyramid; sahura
From left to right: Exterior view of the pyramid. A passage secured with steel beams. One of the discovered storage rooms.
Credit: Mohamed Khaled
Credit: Mohamed Khaled

1 posted on 09/30/2023 8:39:06 AM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...

2 posted on 09/30/2023 8:39:46 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

Archaeologica -- September 27th/28th, 2023 Edition

3 posted on 09/30/2023 8:44:21 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Shoddy construction. Couldn’t even survive 4000 years.


4 posted on 09/30/2023 9:09:43 AM PDT by Revel
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Those pyramid schemes never work out.


5 posted on 09/30/2023 9:11:42 AM PDT by Larry Lucido (Donate! Don't just post clickbait!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Revel
Shoddy construction. Couldn’t even survive 4000 years.

I'm working on a 5,000 year project, and would appreciate your input.

6 posted on 09/30/2023 9:15:00 AM PDT by null and void (I am fine with liberal cities eating the results of their recipes. H/T ConservativeMind)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

The young girls they buried alive with ‘The King’ needed closet space. Duh. ;)


7 posted on 09/30/2023 9:16:59 AM PDT by Diana in Wisconsin (I don't have, 'Hobbies.' I'm developing a robust Post-Apocalyptic skill set. )
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

It’s a fixer-upper.


8 posted on 09/30/2023 10:04:23 AM PDT by martin_fierro (< |:)~)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Revel; Larry Lucido; Diana in Wisconsin; martin_fierro

lol


9 posted on 09/30/2023 10:17:38 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

Same ol story.
Someone builds a nice place with plenty of rooms.
People come and hang out.
They leave their debris and rubish.
Pretty soon the place is full of debris ad rubish.
Nobody wants to go there anymore.
People forget about it.


10 posted on 09/30/2023 11:02:12 AM PDT by DannyTN
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void
"I'm working on a 5,000 year project, and would appreciate your input."

My suggestion is to use a metal roof, they last much longer than tar paper.

11 posted on 09/30/2023 11:14:29 AM PDT by fini
[ Post Reply | Private Reply | To 6 | View Replies]

To: null and void; SunkenCiv

I built a city 5000 years ago and when I went back 1000 years later to check on it, it was under another city!


12 posted on 09/30/2023 12:33:52 PM PDT by Larry Lucido (Donate! Don't just post clickbait!)
[ Post Reply | Private Reply | To 6 | View Replies]

To: SunkenCiv

I bet they find a man cave somewhere deep there underground.


13 posted on 09/30/2023 2:51:16 PM PDT by minnesota_bound (Need more money to buy everything now)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Cool (since it is underground)


14 posted on 10/01/2023 5:13:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DannyTN; Larry Lucido

I’ve got a sidebar on deck about stratification.

https://www.youtube.com/watch?v=fz4ZdXpri04


15 posted on 10/01/2023 10:37:17 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 10 | View Replies]

[snip] David Warther II, born in 1959, is a master ivory carver living near the city of Dover in northeast Ohio. According to David's parents, he began carving from elephant tusk ivory at the age of three. At the age of six, David carved his first ship, a Viking vessel. With the creation of his first ship, David's destiny was launched and he began carving even more ships with a passion and a keen interest in detail that has now spanned over fifty years. [/snip]
Year: 2540 BC
Category: Ancient
Vessel Type: Merchant Ship
Scale: 1/8" = 1 foot
Overall Length: 65 feet

As early as the 26th Century B.C. The Egyptians built sturdy ocean-going ships, like this one, to travel to the land of Punt in search of Myrrh, Gold, Ivory, and Ebony.At one time the Egyptians traded with the Punt peoples, pound for pound, salt for gold.

The Egyptians sailed the Red Sea to the Indian Ocean and then down the coast of Africa to the "Land of Punt" which lay along the central African coast. Punt voyages took about 2 years to complete and the Egyptians kept the location so much a secret that scholars are still unsure of Punt's location. Maritime scholar-historian Bjorn Landstrom believed the location was up the Zambezi river where explorers in the 1800's found all of the flora and fauna attributed to Punt from ancient Egyptian writings as well as played out gold mines.

Punt voyages were carried on for over a thousand years with the most famous one's being conducted by Queen Hatshepsut during the 18th Dynasty (see her ship in the Warther collection as well).
The Punt Ship of Pharaoh Sahure
The Punt Ship of Pharaoh Sahure

16 posted on 10/06/2023 7:57:18 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Giant Pyramid Buried in Indonesia Could Be The Oldest in The World
https://www.sciencealert.com/giant-pyramid-buried-in-indonesia-could-be-the-oldest-in-the-world
03 November 2023
ByCARLY CASSELLA


17 posted on 11/04/2023 6:50:07 AM PDT by BenLurkin (The above is not a statement of fact. It is either opinion, or satire, or both.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

There is no giant pyramid buried in Indonesia, any more than there is one in the former Yugoslavia, or Antarctica. Oddly enough, there is small group of good-sized pyramids in China...


18 posted on 11/04/2023 8:13:35 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 17 | View Replies]

Dr. Robert Cargill, Roger A. Hornsby Associate Professor in the Classics at the University of Iowa and Editor of Bible & Archaeology, counts down the top ten biblical archaeology discoveries of 2023 from the Mediterranean and southwestern Asia, presented by Marshalltown.
Top Ten Biblical Archaeology Discoveries of 2023 Presented by Marshalltown
Bible & Archaeology
| 14:24
XKV8R — Robert R. Cargill, PhD | 98.7K subscribers | 6,444 views | December 31, 2023
Top Ten Biblical Archaeology Discoveries of 2023 Presented by Marshalltown | Bible & Archaeology | 14:24 | XKV8R — Robert R. Cargill, PhD | 98.7K subscribers | 6,444 views | December 31, 2023
Transcript
0:01·hey I'm Dr Bob Cargill editor of Bible
0:04·and archaeology 2023 has been another
0:07·great year for biblical archaeology and
0:09·we here at Bible and archaeology are
0:11·pleased to present the top 10
0:14·archaeological discoveries of 2023
0:17·presented by Marshall toown the maker of
0:20·the Premier archaeological tool the
0:22·Marshall Town hand TR used in
0:24·excavations around the world not only
0:28·made in the USA but made right here in
0:32·Iowa go Hawks so here they are the top
0:35·10 biblical archaeology discoveries of
0:38·2023 number
0:40·10 soraa's pyramid reveals new rooms
0:45·Specialists working to conserve and
0:47·restore the sahura pyramid which was
0:49·built approximately 4,400 years ago for
0:52·the Pharaoh sahura announced the
0:55·discovery of a series of previously
0:57·unknown rooms within the pyramid the
0:59·team team used 3D laser scanning tools
1:02·to create a detailed survey of the
1:05·interior of the pyramid mapping its
1:07·corridors and Chambers it was during
1:10·this process that the team identified a
1:14·passageway that led them to eight
1:17·previously undiscovered stor rooms while
1:20·the rooms were empty and badly damaged
1:23·remnants of the original walls and floor
1:25·are still visible the team was also able
1:28·to secure the pyramid's IAL Chambers
1:31·which had been previously inaccessible
1:33·number nine a monument of the Goddess
1:36·Ishtar on Earth at nimod archaeologist
1:39·from the University of Pennsylvania
1:41·Excavating in the ancient city of nimod
1:44·discovered a large stone monument of the
1:46·Goddess Ishtar this find is just one of
1:50·the new discoveries to come from the
1:52·excavations at nimd the stone monument
1:55·in question depicts the goddess Ishtar
1:57·inside a star which archae ol ologists
2:00·have declared to be the first
2:01·unequivocal depiction of Ishtar sherat
2:04·Nei an aspect of the Goddess that is
2:08·connected with the rising of Venus this
2:10·find joins another Discovery from this
2:13·year of a separate stone monument which
2:16·depicts Ishtar alongside the Assyrian
2:19·King Asher narip II number eight a new
2:23·Papyrus with early sayings of Jesus a
2:27·Papyrus fragment believed to contain
2:30·sayings of Jesus and dating to the 2
2:33·Century CE was published this year the
2:36·fragment comes from the oxy rinkus
2:38·collection which is a group of papy
2:40·fragments numbering over half million
2:43·that were excavated from ancient
2:44·Egyptian trash sheeps in the late 19th
2:47·and early 20th centuries and which range
2:49·in date from the 3r century BCE to the
2:53·7th Century CE scholars believe the
2:56·fragment contains sayings of Jesus and
2:59·it has been dated on the basis of
3:02·paleography to the 2 Century CE making
3:05·it one of the earliest known pieces of
3:08·Christian writing to date while the
3:11·fragment itself does not contain the
3:13·phrase Jesus said scholars believe the
3:17·fragment is a collection of sayings
3:19·attributed to Jesus containing no
3:22·narrative what is commonly known as a
3:24·Sang's gospel however they do not
3:27·believe that this fragment is the
3:29·theoretical Q Source known from Matthew
3:32·and Luke as it varies from these gospels
3:35·in important ways number seven Egyptian
3:39·evidence of a female pharaoh
3:41·archaeologists Excavating the tomb of
3:43·Merit Neath this year uncovered hundreds
3:46·of sealed wine jars and a series of
3:49·inscriptions despite being buried some
3:51·5,000 years ago the jars are in a
3:54·remarkable state of preservation and
3:57·many of them are still sealed the the
3:59·jars have been identified as wine jars
4:02·on the basis of the organic residue left
4:04·inside them including the presence of
4:06·grap Pips archaeologists also found
4:09·inscriptions in the Tomb that describe
4:11·Merit Neath as being responsible for
4:14·government
4:15·offices these tablets provide new
4:17·information about Merit Neath who is
4:19·known from Egyptian records as a consort
4:22·and Regent during the first dynasty but
4:24·is believed by some Scholars to have
4:26·been the first female pharaoh of Egypt
4:30·number six Scholars squeeze the first
4:34·word from scorched vuia scroll the
4:37·carbonized herculanum Scrolls revealed
4:39·their first word this year the discovery
4:41·came as part of the vvus challenge a
4:44·contest created by Dr seals at the
4:46·University of Kentucky intended to draw
4:49·researchers to the project of improving
4:51·the use of AI to identify words within
4:55·x-ray images from the still rolled
4:57·herculanum Scrolls a collection of 800
5:01·Scrolls charred by the eruption of vvus
5:04·in 79 CE the successful identification
5:08·of the first word was announced this
5:09·year as Luke ferer a computer science
5:12·student at the University of Nebraska
5:15·was able to successfully identify the
5:17·word porus meaning purple or purple die
5:20·from a fragment of one of the Scrolls
5:22·earning Luke a $40,000 prize number five
5:27·a rare 2300 year-old Bron 's mirror
5:30·found in a Jerusalem grave in September
5:33·the Israel Antiquities Authority
5:35·announced that during a salvage
5:37·excavation conducted in 2019 before the
5:41·construction of the Hebron Road in
5:43·Jerusalem a cave was discovered that
5:46·contained the burial of a young woman
5:48·and a rare bronze mirror from the
5:50·helenistic period dating to the fourth
5:53·or 3rd Century
5:55·bcee the tomb which has been identified
5:58·as the tomb of a Tyra or Greek cortison
6:02·was carved into the Limestone Bedrock it
6:05·consisted of a shaft likee entrance room
6:08·and an interior burial chamber both of
6:11·which were plastered while the entrance
6:13·to the burial chamber was sealed shut
6:16·with bitamin from the Dead Sea the
6:19·bronze folding box mirror found inside
6:22·the tomb is extremely rare as this
6:25·example is one of only two to have been
6:28·found in Israel
6:30·and one of just 63 known from the
6:32·helenistic world number four Bronze Age
6:36·brain surgery at middo archaeologists
6:38·from the excavations at megiddo in
6:40·Israel announced this year that evidence
6:43·of cranial surgery had been found during
6:46·their excavations the signs of surgery
6:48·were found on the bones of one of two
6:50·brothers found buried below the floor of
6:53·a Bronze Age house in megiddo which
6:55·archaeologists have dated to between
6:57·1550 and 1450
7:00·BCE in a paper published in the journal
7:02·plus one researchers stated that this
7:05·discovery is one of the Region's
7:07·earliest examples of cranial tonation a
7:11·procedure where a hole is created in the
7:13·skull commonly identified as one of the
7:16·first three procedures that marked the
7:19·dawn of surgery unfortunately for this
7:22·ancient individual the report notes a
7:25·lack of evidence of healing around the
7:27·site of the procedure indicating that
7:29·the individual died not long after the
7:32·operation occurred number three a
7:34·4,000-year-old Canaanite Arch is found
7:37·in Northern Israel archaeologists
7:39·Excavating at Tel shimron in Northern
7:42·Israel announced the discovery of a
7:44·4,000-year-old Canaanite Arch the coral
7:47·Archway was found during excavations at
7:50·the site's middle Bronze Age Acropolis
7:53·the discovery of such an archway is rare
7:55·in the region especially given its level
7:58·of preservation
8:00·as the arch is made of sundried mud
8:02·brick the closest parallel for this
8:04·Archway in Israel is the triple arched
8:07·gate at tan the brick architecture seen
8:11·in this Arch is similar to the type seen
8:14·in Northern Syria and Mesopotamia during
8:16·the middle Bronze Age the purpose of the
8:19·archway is still unknown as excavation
8:21·of the passageway in the connected
8:23·building is still ongoing number two
8:26·ancient toilets reveal denter in Old
8:29·Testament Jerusalem a study of fecal
8:32·matter taken from cesspits below two
8:34·Iron Age toilets in Jerusalem have
8:36·revealed the presence of the dissenter
8:39·causing parasite Giardia which
8:42·researchers say is the earliest known
8:44·evidence of giardia the samples in
8:46·question were taken from the sediment
8:48·layers in the cesspits below the
8:51·respective toilets that are located in
8:53·two separate Elite building complexes
8:56·south of the old city one toilet comes
8:59·from from the estate of Arman haniv that
9:01·archaeologists believe dates to the 7th
9:04·Century BCE the second toilet is located
9:07·in what is commonly referred to as the
9:09·house of AEL in the city of David
9:12·excavations and is located in a seven
9:14·room domestic structure which
9:16·archaeologists believe dates to around
9:19·the 8th Century
9:20·bcee the researchers state that quote
9:24·the fact that these parasites were
9:26·present in sediment from two age
9:29·Jerusalem cesspits suggest that denter
9:33·was endemic in the Kingdom of
9:36·Judah speaking of number two before we
9:39·get to our top discovery of 2023 we need
9:42·to address two stinkers that were
9:46·dropped on the world of archaeology this
9:48·year our bottom of the cess pit Not Top
9:51·10 stinker number one the so-called
9:55·Darius
9:56·inscription this unfortunate discovery
9:59·was retracted almost as immediately as
10:02·it was announced apparently someone
10:04·inscribed a piece of pottery with the
10:06·name of the Persian king duras or Darius
10:09·on it and many of us immediately smelled
10:12·something hello suspicious a few days
10:16·later a massive mopa was released
10:19·stating that the forged inscription was
10:22·a teaching exercise G aai but not before
10:25·this unprovided inscription was
10:27·announced to the public days before
10:30·purum this admittedly fake inscription
10:33·reminds us yet again not to publish
10:36·unprovenanced objects and lands at
10:39·stinker number one on this year's list
10:42·of things we should ignore and our very
10:45·bottom of the cess pit Not Top 10
10:48·stinker number two the deuce of Deuces
10:51·and the biggest pile of shabbat shalom
10:54·that we saw this year the publication of
10:58·the Mount of ball piece of hello
11:02·lead as we have chronicled over and over
11:06·and over and over and over again on this
11:11·channel our fundamentalist friends
11:14·Hawking the so-called Mount Abal
11:17·inscription finally found a place to
11:19·publish their claims of a tsunami of an
11:22·inscription that would supposedly undo
11:25·all of biblical scholarship and all of
11:29·IAL archaeology and if it sounds too
11:31·good to be true that's because it is
11:35·this thing went over like a lead clasp
11:39·that's it because that's all it ever was
11:43·a degrading piece of lead from a
11:46·40-year-old dump pile that served as a
11:49·fundamentalist Roar Shack test
11:52·archaeological paradia for those wanting
11:55·to believe things that real archaeology
11:58·doesn't support report this Mount Abal
12:00·claim was borne online as a press
12:02·conference and a YouTube video and
12:05·that's where it will die in social media
12:08·because Scholars and legitimate
12:10·Publications don't publish unproven
12:14·objects and don't publish responses to
12:17·madeup unprovenanced
12:20·nonsense in legitimate
12:22·Publications this Mount Abal balagan is
12:26·now a few years old but it finally got
12:29·published meaning it gets one last
12:31·mention in our list of things to ignore
12:35·in
12:36·2023 and may it rest in peace and now
12:41·our number one biblical archaeology
12:44·discovery of
12:45·2023 dead sea caves produced 1900 year
12:49·old Roman swords four Roman era swords
12:53·were discovered this year in a cave near
12:55·the Dead Sea the discovery came as a
12:59·part of the ia's Judean desert survey a
13:02·project that aims to document and
13:04·excavate the caves near the Dead Sea in
13:07·the hopes of finding Scrolls before
13:09·lutters do following the discovery of
13:12·one sword researchers returned to search
13:15·the whole cave in total the cave
13:18·produced three Roman long swords with
13:21·their wooden scabbards a shorter ring
13:24·pommel Sword and the head of a javelin
13:27·all of which have been dated by their
13:29·typology to the 2 Century
13:32·CE archaeologists think the swords were
13:35·likely taken as plunder from the
13:36·battlefield by Jewish Rebels and hidden
13:40·for later reuse possibly during the
13:43·baroka revolt and that completes our
13:46·list of the top biblical archaeology
13:48·discoveries of 2023 what do you think of
13:50·our list what do you think should be at
13:52·the top leave a comment below and I'll
13:55·be happy to explain why we left other
13:58·discoveries off our list and remember
14:01·you can visit Bible and archaeology all
14:03·year long for your archaeology news
14:06·updates for all of us here at Bible and
14:09·archaeology I'm Dr Bob Cargill wishing
14:11·you a happy New Year and everything the
14:23·best

19 posted on 01/01/2024 11:22:32 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson