Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

7 Lost Cities (that could still be found) [8:35]
YouTube ^ | December 8, 2023 | Garrett Ryan (as toldinstone)

Posted on 12/11/2023 8:19:53 AM PST by SunkenCiv

Chapters:
0:00 Formerly lost cities
2:30 Ekster
3:32 Suburbs of Pompeii
5:01 Tripergole
5:45 Helike and other drowned cities
6:44 Tigranocerta
7:12 Ptolemais Theron and Muziris
7 Lost Cities (that could still be found) | 8:35
toldinstone | 444K subscribers | 69,473 views | December 8, 2023
7 Lost Cities (that could still be found) | 8:35 | toldinstone | 444K subscribers | 69,473 views | December 8, 2023

(Excerpt) Read more at youtube.com ...


TOPICS: History; Science; Travel
KEYWORDS: archiveofthesulpicii; armenia; boscoreale; boscotrecase; derinkuyu; epigraphyandlanguage; garrettryan; godsgravesglyphs; greece; helike; herculaneum; lostcities; mountsipylus; murecine; muziris; pausanias; petra; phlegraeanfields; pompeii; ptolemaistheron; romanempire; sulpicii; thesulpicii; tigranocerta; timgad; toldinstone; tripergole; vesuvius; wadimusa
Transcript
·Formerly lost cities
0:08·Many ancient cities have been abandoned.
0:11·Many more have vanished beneath modern buildings and modern names.
0:16·But only a few have truly disappeared from human knowledge.
0:20·The most famous examples are Herculaneum and Pompeii, buried by Vesuvius during the eruption
0:25·of 79 AD.
0:28·Local farmers had been uncovering artifacts above the site of Pompeii for centuries, and
0:33·called the area around the half-buried amphitheater "La Civita" – the city.
0:37·But it was only in 1709, when workmen digging a well struck the marble seats of Herculaneum's
0:44·theater, that the first excavations under Vesuvius began.
0:48·And it was only after years of clearing and tunnelling that inscriptions definitively
0:53·proving the identity of the two cities were discovered.
0:57·Other lost cities were hidden, at least from the perspective of European scholars, by their
1:02·remoteness.
1:03·A famous case is Petra, forgotten until 1812, when the intrepid Swiss explorer Johann Burckhardt
1:10·reached the place that the local Bedouin called Wadi Musa – "the Valley of Moses."
1:15·Timgad, the so-called "African Pompeii," had been abandoned for a millennium by the
1:20·time James Bruce, a wandering Scottish nobleman, stumbled upon its ruins in 1765.
1:27·His description of a well-preserved Roman city on the edge of the Sahara was disbelieved
1:32·until the late nineteenth century, when a new generation of explorers surveyed and photographed
1:38·the ruins.
1:40·Discoveries continued into the twentieth century.
1:42·In 1963, for example, a man in the Turkish town of Derinkuyu found a mysterious void
1:48·behind the wall of his cellar.
1:50·This proved to be an entrance to a vast subterranean town, constructed and enlarged during the
1:56·Roman and Byzantine periods.
1:57·Its 18 levels had room for some 20,000 inhabitants, and featured a wine press, stables, and several
2:06·churches.
2:07·Many ancient cities are known but unexcavated – either inaccessible beneath modern development,
2:13·too remote for ready access, or languishing from inadequate funding.
2:18·But even after decades of intensive surveys and aerial photography, there are a handful
2:23·of ancient cities that are still truly lost, as we'll see after a brief word about this
2:28·video's sponsor.
·[sponsor text omitted]
3:30·Returning to our topic.
·Suburbs of Pompeii
3:32·Herculaneum and Pompeii, the most famous lost cities, are only partly excavated, and the
3:38·suburbs, villages, and villas that surrounded them are largely unexplored.
3:44·Over the past three centuries, chance discoveries have revealed dozens of elaborate Roman villas
3:49·in the districts of Boscoreale and Boscotrecase, just north of Pompeii.
3:55·One of these villas – excavated and then reburied in the late nineteenth century – produced
4:00·the Boscoreale Treasure, which contained some of the greatest masterpieces of Roman silverwork
4:05·ever discovered.
4:07·The villa of Publius Fannius Synistor was decorated with a series of spectacular frescoes,
4:13·now a highlight of the Greek and Roman collection in New York's Metropolitan Museum of Art.
4:19·In 1906, shortly after the frescoes had been detached, an eruption of Vesuvius buried the
4:25·remains of the villa beneath a fresh blanket of volcanic debris.
4:29·Many other villas in the vicinity await rediscovery.
4:34·So does the town of Murecine, a suburb of Pompeii.
4:38·A few mansions were discovered here in the eighteenth century, then reburied and lost.
4:43·In the years since, sporadic discoveries have produced such marvels as a sprawling villa
4:48·with a private bath and the Archive of the Sulpicii – the most detailed set of financial
4:53·records to survive from the Roman world.
4:57·We can only guess at what else is hidden under the ashes.
·Tripergole
5:01·Across the Bay of Naples from Pompeii and Vesuvius are the smoking pits and fumaroles
5:06·of the Phlegraean Fields, another volcanic hot spot.
5:10·Here, beside a series of hot springs, the Romans built elaborate baths, domed and vaulted
5:16·with concrete.
5:17·These structures survived to be drawn by Renaissance architects.
5:21·But on the morning of September 29, 1538, a crack opened beside Tripergole, the town
5:27·that had grown up among the Roman baths.
5:30·Smoke rose from the fissure, then surging fountains of lava.
5:34·In less than a day, a volcano more than 400 feet high came into being, covering Tripergole
5:39·and the Roman baths.
5:41·Nobody knows where, or how deeply, the ruins are buried.
·Helike and other drowned cities
5:45·Equally dramatic disasters claimed other ancient settlements.
5:49·On a winter night in 373 BC, the Greek city of Helike was struck by a severe earthquake.
5:56·The ground liquified, tsunamis roared over the harbor, and the whole town – walls,
6:00·temples, and people – sank beneath the waves.
6:05·Not even the sailors aboard a Spartan fleet anchored offshore escaped.
6:10·Only ruins remained, ghostly under the sea, until even these were covered by mud and lost.
6:16·Not until 2001, after decades of searching, was the city finally rediscovered.
6:23·Other sunken cities are still lost.
6:25·According to the Greek geographer Pausanias, a city on the slopes of Mount Sipylus, in
6:30·what is now Turkey, disappeared into a vast chasm during an earthquake.
6:34·A lake formed in the basin, and the city's ruins could long be seen at the bottom.
6:40·If this city ever existed, it has not been located.
·Tigranocerta
6:44·Other lost cities were destroyed by human hands.
6:47·Tigranocerta, the capital of ancient Armenia's greatest king, was captured by the Roman general
6:53·Lucullus in 69 BC.
6:55·It was looted so thoroughly that 8,000 talents – that is, more than 400,000 pounds – of
7:01·silver were taken from the ruins.
7:04·Then the city was burned, and its inhabitants dispersed.
7:08·Its site has never been conclusively located.
7:11·Remote outposts of the classical world often disappeared when the trade that sustained
·Ptolemais Theron and Muziris
7:16·them vanished.
7:18·Ptolemais Theron – an important Hellenistic trading center on the coast of the Red Sea
7:22·– has never been found.
7:24·Nor, probably, has Muziris, the rich settlement on the Malabar Coast that served as the center
7:30·of Rome's trade with India.
7:33·Muziris may have been destroyed by a Medieval cyclone.
7:36·But most lost ancient cities vanished simply because their inhabitants did – driven or
7:41·drifting away, taking their traditions and memories with them.
7:45·Then, unless some record survives to be read by historians, only silence and the stones
7:51·remain.
7:55·My new book – Insane Emperors, Sunken Cities, and Earthquake Machines – is now available
8:01·as a paperback, e-book, and audiobook.
8:04·You can buy your copy through Amazon, Barnes & Noble, or your local bookstore.
8:11·For more toldinstone content, check out my channels Toldinstone Footnotes and Scenic
8:16·Routes to the Past, which are linked in the description.
8:20·Please consider joining other viewers in supporting toldinstone on Patreon.
8:24·Thanks for watching.

1 posted on 12/11/2023 8:19:53 AM PST by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...

2 posted on 12/11/2023 8:23:07 AM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

If they know where they are they are not lost................


3 posted on 12/11/2023 8:32:15 AM PST by Red Badger (Homeless veterans camp in the streets while l aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 2 | View Replies]

https://www.google.com/search?q=mount+sipylus


4 posted on 12/11/2023 8:39:47 AM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

I wonder how many ancient cities are buried under the Sahara.


5 posted on 12/11/2023 8:42:33 AM PST by Dutch Boy (The only thing worse than having something taken from you is to have it returned broken. )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger
Always in the last place ya look, unless ya got the identification wrong of course. :^)

I like how GR kept a tight focus and only covered seven, but offhand mentioned for example the city that slid down Mount Sipylus and into the lake that's still there, per one ancient source. Eberhard Zangger posits that the destruction of the currently unverified city is the "real" Atlantis.

6 posted on 12/11/2023 8:43:01 AM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Dutch Boy

Same here.

https://freerepublic.com/tag/saharaforest/index

https://freerepublic.com/tag/garamantes/index

https://freerepublic.com/tag/sahara/index


7 posted on 12/11/2023 8:48:58 AM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Dutch Boy

From the Sahara Desert to the Sahara Forest...21,000 year cycle. So there might be 300 lost cities from each cycle...ponder that. Same for southern half of Africa and the various irrigation canals that have to be over 13,000 years old.


8 posted on 12/11/2023 8:51:24 AM PST by pepsionice
[ Post Reply | Private Reply | To 5 | View Replies]

To: Red Badger

Another way to look at this is that cities serve a purpose, if that purpose no longer exist they cease to exist.

The insane climate change warriors act as if a city is some how important because it is a city and not because of the function. Let us say that the climate warriors are correct and New York sinks into the the ocean. Would New York be rebuilt or abandoned? Personally I think New York has lost it’s reason to exist and if destroyed would not be rebuilt as it was (but if rebuilt it would be for another purpose).

Climate change is real but instead of destroying your culture, economy, and nation why not simply plan on how to adapt to any climate change? Before air conditioning there were many places in the US uncomfortable to live and work, that is technology that helps us adapt to hot climates.


9 posted on 12/11/2023 8:54:48 AM PST by CIB-173RDABN (I am not an expert in anything, and my opinion is just that, an opinion. I may be wrong.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: CIB-173RDABN

Cities move and flourish or fail with the times.

Many Roman era coastal towns around Europe are now under water, but they were ports and trading centers in their times.

A ‘city’ is not a permanent dwelling place.

See ‘Babylon’, ‘Thebes’, ‘Nineveh’, ‘Carthage’, ‘Angor Wat’, et al...........................


10 posted on 12/11/2023 9:03:04 AM PST by Red Badger (Homeless veterans camp in the streets while l aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Red Badger

Port Royal Earthquake of 1692

Port Royal is a town located at the end of the Palisadoes, at the mouth of Kingston Harbour, in southeastern Jamaica. Founded in 1494 by the Spanish, it was once the largest city in the Caribbean, functioning as the centre of shipping and commerce in the Caribbean Sea by the latter half of the 17th century.[1] It was destroyed by an earthquake on 7 June 1692, which had an accompanying tsunami, leading to the establishment of Kingston, which is now the largest city in Jamaica. Severe hurricanes have regularly damaged the area. Another severe earthquake occurred in 1907.

Port Royal was once home to privateers who were encouraged to attack Spanish vessels, at a time when smaller European nations were reluctant to attack Spain directly. As a port city, it was notorious for its gaudy displays of wealth and loose morals. It was a popular homeport for the English and Dutch-sponsored privateers to spend their treasure during the 17th century. When those governments abandoned the practice of issuing letters of marque to privateers against the Spanish treasure fleets and possessions in the later 16th century, many of the crews turned pirate. They continued to use the city as their main base during the 17th century. Pirates from around the world congregated at Port Royal, coming from waters as far away as Madagascar.

After the 1692 disaster, Port Royal’s commercial role was steadily taken over by the nearby town (and later, city) of Kingston. Plans were developed in 1999 to redevelop the small fishing town as a heritage tourism destination to serve cruise ships. The plan was to capitalize on Port Royal’s unique heritage, with archaeological findings from pre-colonial and privateering years as the basis of possible attractions.[1]


11 posted on 12/11/2023 9:06:54 AM PST by Pikachu_Dad
[ Post Reply | Private Reply | To 10 | View Replies]

To: SunkenCiv
Here are three:

Jomsborg or Jómsborg (German: Jomsburg) was a semi-legendary Viking stronghold at the southern coast of the Baltic Sea (medieval Wendland, modern Pomerania), that existed between the 960s and 1043. Its inhabitants were known as Jomsvikings. Jomsborg’s exact location, or its existence, has not yet been established, though it is often maintained that Jomsborg was located on the eastern outlet of the Oder river. Historian Lauritz Weibull dismissed Jomsborg as a legend.

https://en.wikipedia.org/wiki/Jomsborg

Rungholt was a settlement in North Frisia, in what was then the Danish Duchy of Schleswig. The area today lies in Germany. Rungholt reportedly sank beneath the waves of the North Sea when a storm tide (known as Grote Mandrenke or Den Store Manddrukning) hit the coast on 15 or 16 January 1362. The exact location of Rungholt has yet to be conclusively identified.

https://en.wikipedia.org/wiki/Rungholt

Noreia is an ancient lost city in the Eastern Alps, most likely in southern Austria. While according to Julius Caesar it is known to have been the capital of the Celtic kingdom of Noricum, it was already referred to as a lost city by Pliny the Elder (AD 23 – AD 79). The location of Noreia has not been verified by modern researchers.

https://en.wikipedia.org/wiki/Noreia

12 posted on 12/11/2023 9:16:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Many Roman era coastal towns around Europe are now under water, but they were ports and trading centers in their times


A point I have made often.

The arguments against “man made climate change” is so easy to make you have to wonder why those in power (government) or in the media don’t make them. Could it be they are all in on the lie?


13 posted on 12/11/2023 9:19:24 AM PST by CIB-173RDABN (I am not an expert in anything, and my opinion is just that, an opinion. I may be wrong.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: AdmSmith
Thanks! I can't seem to find it, but there's a topic about an earlier flood / tsunami cited anecdotally by a Roman source that struck the North Sea coastline of mainland Europe.

14 posted on 12/11/2023 4:38:32 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 12 | View Replies]


15 posted on 12/11/2023 4:41:25 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 14 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson