Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Scholars say Philistine genes help solve biblical mystery
www.wpri.com ^ | Posted: Jul 3, 2019 / 02:13 PM EDT / Updated: Jul 3, 2019 / 02:21 PM EDT | by: ILAN BEN ZION

Posted on 07/03/2019 1:16:54 PM PDT by Red Badger

JERUSALEM — Goliath the Greek? Human remains from an ancient cemetery in southern Israel have yielded precious bits of DNA that a new study says help prove the European origin of the Philistines — the enigmatic nemeses of the biblical Israelites.

The Philistines mostly resided in five cities along the southern coast of what is today Israel and the Gaza Strip during the early Iron Age, around 3,000 years ago. In the Bible, David fought the Philistine giant Goliath in a duel, and Samson slew a thousand of their warriors with the jawbone of an ass.

Many archaeologists have proposed they migrated to the coast of the ancient Near East during a period of upheaval at the end of the Late Bronze Age, around 1200 B.C.

The Philistines emerged as other societies around the eastern Mediterranean collapsed, possibly because of a cataclysmic intersection of climate change and man-made disasters. Philistine ceramics bear similarities to styles found in the Aegean, but concrete evidence of their geographic origins has remained elusive.

Now, a study of genetic material extracted from skeletons unearthed in the Israeli coastal city of Ashkelon in 2013 has found a DNA link. It connects the Philistines to populations in southern Europe during the Bronze Age.

The study, spearheaded by researchers from Germany’s Max Planck Institute and Wheaton College in Illinois, was published Wednesday in the research journal Science Advances.

The biblical account relates that the Philistines originally hailed from a distant isle. An Egyptian temple built by Rameses III bears reliefs of battles with “Sea Peoples” who appeared on the shores of the eastern Mediterranean. One group listed in the Egyptian text is strikingly similar to the Hebrew name for Philistines. Excavations of Philistine sites have found ceramics and architecture that differed from those of their neighbors in ancient Canaan.

But archaeologists can’t be absolutely certain that different pots mean different people.

Eric Cline, an archaeologist from George Washington University specializing in the Late Bronze Age in the Near East, said conclusive evidence has eluded scientists until now — even if the material remains have indicated that the Philistines migrated to the Levant from the Aegean around 1200 B.C.

Cline, who was not involved in the study, is the author of “1177 BC: The Year Civilization Collapsed,” which examines the period when the Philistines arrived. He called the paper’s findings “extremely exciting and very important” by helping resolve the long-standing mystery about their origins.

“We were all hoping that it might be possible to get genetic information like this,” he said. “Now we have scientific confirmation from DNA that the Philistines do indeed most likely come from that region.”

The researchers looked at DNA from 10 skeletons excavated from the ancient cemetery in Ashkelon, one of the Philistine seaports.

Using Carbon-14 dating technology, three were determined to be from the centuries before the Philistines’ presumed arrival around 1200 B.C., four were from the period immediately afterward, and three dated to centuries further on, the late Iron Age.

The study found that the remains dating to the early Iron Age — the period associated with many of the stories involving Philistines in the Bible — were genetically distinct from their Levantine neighbors, and had close similarities with populations in southern Europe.

“We see in their DNA a European component from the West that appears in a substantial enough way that we can demonstrate it statistically, we can show that it’s different,” said Daniel Master, an archaeologist with Wheaton College who headed the expedition in Ashkelon. “It basically says the people came from outside, not just the style of pottery.”

He said the findings were “direct evidence” that the cultural change found in Philistine cities “reflected the migration of a group of people.”

The DNA from the later individuals found they had some southern European genes, but appeared much closer to the surrounding Canaanite population.

“There was this pulse of people coming in, and then they kind of mixed in into the local population, so a few hundred years later they are almost indistinguishable” from the surrounding Levantine gene pool, said Michal Feldman, an archeogeneticist at the Planck Institute and one of the paper’s lead authors.

The results point to a possible southern European origin for the Philistines — anywhere from Cyprus to Sardinia — but further study of ancient remains is needed to narrow down the search.

“Until we have more samples from the neighboring regions,” and from the Philistines themselves, said Feldman, “I don’t think we can pinpoint better their homeland or homelands.”


TOPICS: History; Religion; Science; Travel
KEYWORDS: 1177bc; amos9v7; archaeology; ashkelon; bronzeagecollapse; caphtor; carians; catastrophism; cyprus; deuteronomy2v23; epigraphyandlanguage; ericcline; erichcline; genesis10v14; ggg; godsgravesglyphs; helixmakemineadouble; hurrians; israel; jeremiah47v4; minoans; mycenaeans; peopleofthesea; philistia; philistine; philistines; seapeople; seapeoples
Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-111 next last
To: SunkenCiv
Goliath was probably Nephilim so does the study insinuate that the Greek were a Pygmy line of the race of Giants, the Nephilim?
61 posted on 07/04/2019 7:35:38 AM PDT by mountainlion (Live well for those that did not make it back.)
[ Post Reply | Private Reply | To 45 | View Replies]

To: mountainlion
at the top:

Ancient DNA sheds light on the genetic origins of early Iron Age Philistines

62 posted on 07/04/2019 8:41:57 AM PDT by Theoria (I should never have surrendered. I should have fought until I was the last man alive)
[ Post Reply | Private Reply | To 60 | View Replies]

To: mountainlion
No, they're just doing science.

63 posted on 07/04/2019 10:57:54 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 61 | View Replies]

To: AdmSmith
I have the book. Too bad he's dead wrong about the dates, and about the Bronze Age "collapse".

64 posted on 07/04/2019 10:59:23 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 57 | View Replies]

To: SunkenCiv

Do you have a link to that?


65 posted on 07/04/2019 11:19:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 64 | View Replies]

To: mountainlion

Yep. Since the Philistines were Israel’s enemy he so named it; but that didn’t create a state of Palestine. That area was ruled first by Israel, then the Romans, then the Ottomans then the Brits who called it the Mandate, then the UN vote to reestablish the area as Israel, then came the Arab invasion, then Israel won and on several other occasions.


66 posted on 07/04/2019 11:26:23 AM PDT by SkyDancer ( ~ Just Consider Me A Random Fact Generator ~ Eat Sleep Fly Repeat ~)
[ Post Reply | Private Reply | To 24 | View Replies]

To: mountainlion

PS: Titus didn’t actually wipe out Israel, there were always Jews in the region with their own towns. The Romans conquered it then ruled it until the Ottomans kicked them out.


67 posted on 07/04/2019 11:27:50 AM PDT by SkyDancer ( ~ Just Consider Me A Random Fact Generator ~ Eat Sleep Fly Repeat ~)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Red Badger

That’s the reason Rome named it Palestine after Israel’s hated enemy.


68 posted on 07/04/2019 11:28:40 AM PDT by SkyDancer ( ~ Just Consider Me A Random Fact Generator ~ Eat Sleep Fly Repeat ~)
[ Post Reply | Private Reply | To 13 | View Replies]

To: AdmSmith
A link to?....

69 posted on 07/04/2019 11:40:04 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 65 | View Replies]

To: SunkenCiv

the correct years as compared to what is in Eric Clines book. - of course you have links ;.)


70 posted on 07/04/2019 11:50:55 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 69 | View Replies]

To: AdmSmith

I’ll work on it! Meanwhile, here’s a new one, followed by two older ones:

http://www.freerepublic.com/tag/bronzeagecollapse/index

http://www.freerepublic.com/tag/erichcline/index

http://www.freerepublic.com/tag/1177bc/index


71 posted on 07/04/2019 12:01:33 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 70 | View Replies]

To: SunkenCiv

Thanks, that will keep me occupied for a month!


72 posted on 07/04/2019 12:05:22 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 71 | View Replies]

To: SunkenCiv

I noticed the Eric has been here http://www.freerepublic.com/tag/by:ehcline/index?tab=comments;brevity=full;options=no-change


73 posted on 07/04/2019 12:19:33 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 72 | View Replies]

To: AdmSmith
I remember it, it was nice of him to stop by. His dating remains wrong. You'll find plenty of posts and links of mine in those keyword topics. :^)

74 posted on 07/04/2019 12:25:20 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 73 | View Replies]

To: Cronos
assimilated by actually means their DNA was absorbed into the main body, not wiped out or exterminated.
75 posted on 07/04/2019 12:41:55 PM PDT by Vigilanteman (The politicized state destroys all aspects of civil society, human kindness and private charity.)
[ Post Reply | Private Reply | To 53 | View Replies]

To: Grampa Dave; centurion316
What you describe in both posts #32 and #41 is largely, though not completely, true. The original Virginia colonists were overwhelmingly male and fortune seekers; those in New England much less so. Over the years, inhibitions broke down as English settlers pushed toward the frontiers. There was a shortage of women willing to join the push, a gap conveniently filled by native tribes who, at least initially, saw the newcomers as potentially useful to absorb into their society.

Even a Patrician blue blooded family like the Bush clan has native Americans intertwined in their New England roots.

My wife is a distant cousin of baseball star Rogers Hornsby descended from a common half-sister of Pocohantas . . . and more than a century later, we have common Cherokee ancestry which married into settler line on the Georgia/Carolina/Tennessee frontiers. There are remote areas still with sizeable Cherokee populations who escaped the forced removal in 1838 either because (a)they were sufficiently intermarried with settlers or (b)in locations too remote and/or numbers too few to bother with rounding up.

76 posted on 07/04/2019 12:58:31 PM PDT by Vigilanteman (The politicized state destroys all aspects of civil society, human kindness and private charity.)
[ Post Reply | Private Reply | To 41 | View Replies]

To: Vigilanteman

What you describe is correct, it’s a matter of degree. Certainly English immigrants intermarried with natives, but every English settlement included women, even early Jamestown. I am a descendant of a family who were on the 2d Supply. Even the Adventurers during the Virginia Company era were interested in establishing wealthly estates that would include English family members.

Spanish and French settlements were almost exclusively male, either military or Adventurers seeking precious metals or jewels. Not very many farmers except among the clergy who were, officially, celebate.


77 posted on 07/04/2019 1:19:52 PM PDT by centurion316
[ Post Reply | Private Reply | To 76 | View Replies]

To: Vigilanteman

Most of the first families of Virginia were descended from Pocahontas. Her line was a very fine thread as most of her line was continued by a single person until one finally had several children.


78 posted on 07/04/2019 1:44:26 PM PDT by yarddog
[ Post Reply | Private Reply | To 76 | View Replies]

To: Vigilanteman

“My wife is a distant cousin of baseball star Rogers Hornsby descended from a common half-sister of Pocohantas . . . and more than a century later, we have common Cherokee ancestry which married into settler line on the Georgia/Carolina/Tennessee frontiers. There are remote areas still with size able Cherokee populations who escaped the forced removal in 1838 either because (a)they were sufficiently intermarried with settlers or (b)in locations too remote and/or numbers too few to bother with rounding up.”

Does this Cherokee lineage show up in your wife’s DNA?

We supposedly via written documentation have lineage with your wife’s ancestor and her father, uncles and aunts. Yet zero DNA showing any Indian blood in our DNA.


79 posted on 07/04/2019 1:44:29 PM PDT by Grampa Dave (KAG! Keep America Great! Vote for President Trump in 2020! KAG! Keep America Great, Again!)
[ Post Reply | Private Reply | To 76 | View Replies]

To: crusher2013

“Exactly. Minoan refugees from the Thera volcano.”

The fact that Dagon is a male diety (and the Minoans were supposedly goddess worshipers) made me doubt this at first, but Dagon is often represented as a fish-man, and fish play a very prominent part in Minoan art. Plus, the Minoans were practitioners of ritual child sacrifice AND cannibalism: there’s lots of evidence from mass graves of children that the kids were butchered just like a food animal. So it would make sense that the local tribes that God so hated in the Old Testament descended from these awful people.

Growing up, I LOVED Greek history, and Minoan history (and it’s mysteries) were a fascination of mine. It was such a disappointment to find out that the people that constructed such beautiful (even magical ) places like the Palace of Knossos were sacrificing and eating their own children in honor of dark deities.


80 posted on 07/04/2019 5:37:35 PM PDT by DesScorp
[ Post Reply | Private Reply | To 7 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 41-6061-8081-100101-111 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson